Gene detail

Detailed information of OS493_020680-T1 in Lophelia pertusa

Genomic Location: scaffold_77:353379...370875
NR annotation: KAJ7358844.1, hypothetical protein OS493_020680 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_020680-T1

ATGGTTGGTGTTTTTCTTTCTAGCATTGGTGTTCTTCCAGTGAGATCTGAGACTGTTGCACTTTCAAATGATGTTGGAAAAATCAAGACAGAGTTAAGGGATATTCTTACTGAAACTGAGAGGCTTAAACAAGAGTTGGTTCAACAGCAACTAGTTAAGGATGATGTTCATTTTCATCCATTACCATTTAGACCAACTGGCCCATCGCCTCTTGATGAATATTTGGAAACAACACATGTATCACATCCACCAAGAAATCCACCAACATCAAAACCATCAGCCTTTTTGCCAACAAACTCACGGTATCACTTTGCTGATGCAGAGCGCATCCTCCAAGATGTTCAGCATCGGCGGCAAAATCTGGATAATAACTTACAGTCTGTGATAAGGCAAAGAGAAGAACAAGATTTATACAACCTGGTGGATAACATTCCCACAACTAATGGCGAGTTTGATGACATGCTGAGAATAAGAAGGGAAGTGGATAAGAGGATAGGAGAGATCAATTCTGCAGTACAGAGAGAAATTATTCGGGAAACCAAAGGTACTTTGCAACAAAAGGAAGATTTGAATCCTTTGAAGAAGCAAAAGTCTCAGCCAGTGAAGCCCACACCATCTGGAGCCAGAAGAGTTGAACCAAGAGTGACGACAAGACCCTTCATAACAGCAAAGAAGCCAGTGAATAAAACCACAGGCAAGGAAAACTTACCAGAGAAGGTCACTGCTAAGAAAGGAAAGGACTCAAGCCCTCCCAAACGTCCTGCGACAGTGACACCCGCACAGAAGCAAGTGTACCTGTCAAGTGTGTATGGCCGTCAACCTTATCACCCGCAGAGAACAACCTCCAAGGCACCGTATCTGCACTACCAGTCTCCTGTCAACCCTAAGACTGCTGCTATAATGGCTGGGATGATGGGTGGTGACGGCAGGGTCACTGCTAAACCAGTGCTACAAGATCTGACAAGCATACCAGAGAAAGACGTTACACAGCCAATAAAGAAAAAGGCTGATGCTGTGGAACCTGTACTTGGTCCTCGTAGACAACAAACCAAGCGCACAGATGACACACAGTATTTTTTTCACCCCAGAGTTGACTTGTCACAAGTTGCTCCTGGGGAGGGGATGTCAAGGGTTGCTGTGCCATTGGAGGGACAGTTGGTGCCTATGGCTATCCCCCTGGGTAAACCCAAGACTGATCCTGCGTTGCGACCTCCAATTTCCACACAAGATGCACAACATACAAGTCAAATGGAAGCTAAAGCAGAAAGCCCCTCACCAGCCAGCACCATATCTACAGACACGACTGAGACCCCATCACCAGACCCCACTCCTGTGAGGCCCAGTAGACCTGCTGGGTCAAACGTGGCAGTGATTACTGTGTATGACAAAGAAATGGGTGAGAGCACAACCCATCAACACAAACGACACAAGAGGTCGCCAGCCAAGAAGAAGCAAAGCTGTCTGTCTGTACAAATGTTACCAAAAGTGGATATTGATAGCTTTTCAGAATCTTCCTCCTCCTCGCCAAGGATGCCTCATATTTCTGAATTTCCAGAGCCTCTTTCCCGCCCTGATGATTCTGAGTACCAGGAATTCAGGAACTTTTTGGCAGTGACAGAGACTGGTGTCCAGGAAAGGCCTGAAGAACAGGCTCCAGATGAGGCAGATGAAGACTTCCACCGAATCCCAACCCCTGAACACCCACTAACACTTGAGGGATTCACAGGAGTACAAAATCAACCGTACAATGGCCCCCCGTTTCCACCTGTGCATCCCCCAGTTTCTTTGCAACATGCAGGGGGAGTCCTTGAAGCTGATACTCGACAAGAGGAAGCTCTACAAGAGAGAGCTATGGAATGGATTGAGCAAGAACTGTTGGCACGTATTGTCAGTGAAATGAACCAACCAGTGCCTGACCCTACCACCCTGATCAGGCCTCACACCACCCCCGACAGTAGCACTGTATCTGAACCTGAAGACGAGGATGCTGATATGCTTGCTGCCACAATAGGTCTGGGTGGAGTTCAGCTCTTTATTGACGCAGGTTTACCAGTGGATAGAGATCTCGTCACTAATTTGATTCGGGAAGTAATAGCAGAGAATGTATCAACAATTCTTGGTCATCCAAAACCAAGAGCCAGCTCTCTTCCTTCAAGACAGCCAGCCATGGAGGAAGAACATCCTTCGCGTACACCATCCCCCAGGGGAACACCAATGGCAACCCCCGCCCCCACCCCCGAGTACACACCCCCTGAGTCAGAGGAGAGTGCTCATGAATCAGAAATACTAGCAACTCCTGAACGCACCCTGACCCCCTCAGTAACAAGCGAGGAGCCGACTCTATCGGATACCAGAGAGGAAGAACAAGCTGTTGAACCAATCAAACAAGAAGTGGATAAGGAAGAGCAGACTAGTGAACAGATTTCCGAGGTAAGAACACCAGTATCTACACCAGTCCCAACGCCACCAGGTGCCCAGTCTTCGCCGGTCAGTATATCTACGCCTGAGCCCTCGCTCCGAGAGCCAGAGGTATCTCAGGATACGGTTGTACCCACGCCACCACCGTCTGCTGTTGTGAAAACACCAACTCCAGAGCCTGAACCCGAGCCGGAGCTTAGCACAGCTGAAGAACCCAGTCAACCTAAGGAACCATCCGTCAGTCAAAAGGAACTGACACCTCCTCAGCCCGCGAAACCTTCGGTCAGCAGTCCGTCGAGCATGTCATCCACCACCCTTGGTACAACGACAATAACTACTGAGGAGGAGATGTCTGAGGGAGAAATGATACAGCCTTATGTGCACGCTGGAATGTACAGTGAAGGAGAGTTTGCTATCTCACCAACCATTGTTCAACTGGCTGCTGAAAGAAAATTACCAGTGAGTGGAGACTGGGACACGACCATGTTAGGACATGATGAAGACAGTCGTAACGAGCTTGTGAGAGTCGCTCTCACTGGCATCTTACAAGGTGGCGAAGGTGGAAAACGAAATCAGCCAGGTTACCGCGAAAGCGGCAGTAGCATTAGTGAGTCTATGCACCAAGTCAGCAGTGCCAGTACTCTAGGGATACAGAGGATATCAGAGAGGATTCCATGA

Transcript

OS493_020680-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q1G7G9	TALPID3 protein OS=Gallus gallus OX=9031 GN=TALPID3 PE=2 SV=2
Q9BVV6	Protein TALPID3 OS=Homo sapiens OX=9606 GN=KIAA0586 PE=1 SV=4
H6D7E6	Protein TALPID3 OS=Danio rerio OX=7955 GN=talpid3 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002502 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15324 all species →	TALPID3	Hedgehog signalling target	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029246 all species →	Family	Protein TALPID3	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15721 all species →	KIAA0586 PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007224 all species →	Biological Process	smoothened signaling pathway	Interproscan
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0036064 all species →	Cellular Component	ciliary basal body	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22865	TALPID3, JBTS23; protein TALPID3	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_020680-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

47.0Max TPM

10.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	10.23	15.38
polyp at pH7 6	18	18	10.40	15.55
coral polyp · control treatment	16	16	12.84	47.03
coral polyp · oil and dispersant treatment	16	16	10.28	41.14
coral polyp · oil treatment	16	16	10.48	18.94
coral polyp · dispersant treatment	16	16	8.21	16.15
Polyp	10	10	10.55	21.95

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.65
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.82
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.75
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.32
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.10
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.13
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.83
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.68
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.63
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.35
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.07
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.18
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.55
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.31
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.56
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.46
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.24
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.08
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.98
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.29
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.86
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.75
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.56
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.51
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.37
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.14
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.07
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.89
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.02
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.03
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.71
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.27
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.50
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.73
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.07
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.30
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.99
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.83
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.41
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.34
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.93
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.26
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.66
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.14
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.08
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.39
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.42
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.65
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.42
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.31
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.88
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.77
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.60
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.48
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.41
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.29
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.02
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.73
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.94
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.56
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.32
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.64
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.41
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.30
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.39
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.30
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.83
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.11
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.09
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.15
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.09
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.12
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.91
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.03
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.48
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.29
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.37
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.78
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.77
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.03
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.98
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.62
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	21.95
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	20.28
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.24
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.54
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.50
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.27
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.65
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.67
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.07

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.