Gene detail

Detailed information of OS493_020895-T1 in Lophelia pertusa

Genomic Location: scaffold_78:1364818...1465199
NR annotation: KAJ7331191.1, hypothetical protein OS493_020895 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_020895-T1

ATGACGATAAGAGTGGAATTGGATCAACTTCTGAATCTTGCTTTAGGTACTCCAGAACTCGGAGCTGTGAACTTTAATATCCTTCATGGAGTATTACGCGAGATTCTCAACCATCTTGGGATTGAAAAGAAGGCCAGGGATATTGGCGATGATGGGAACTTCAGAGCAGCGTTTGCACTGCTTAACAACAAACAGGATAGTTCCCAAGGAGTAGATAAGCACGATGGTGAGGTCGAACGCTCTTCTGTAGAAAGAGGCACAACAGAAAAACCCGGAGACAAAATGCCTTTATCTGCTGCTACAATTTTCCCACCGTTTCATAGTAATTTGGAATCTAAAGTAGCAAACATCGAAAAGAAGTTGGACATATTAGACGATTTGCCTAGTAACGGTGAAATTCTGCAACGCGCCAAGCAAAAGAAGGATGCTAGAACCCCAGTAGCTGATATGTGGCAATTCATAAACATTAATCGAAGACTTGGTGCTACTGAAACTGGCATTGAAAAGCTCACAAGCCTTTTAGACACAATGATGAAGGAAGTTGGTGATGTCAAGGAAGCTGCAGAGGAAATTGATGAGTTAAAGAAAAAGTTAGCAGAGTTGGAGAATTTAAATTCAAGTCTTAGTGAGAGAATTGCAGCACTGGAAAGTGTAGACAACTCAGAGGAGAGAAAGACGATGGAAGATTTGCTCAAGGAGTTGCAAAATCTGAAGAAACAAGTAGACGACCTTCCCACTAAGGATGATCTTAATAATTTGGATATTTATGTCAAATGGCCACAACTTGAAGAGGCTTTAAATGCAAGAAGAAGTCGAACTCCATCTGCAAAATCAAGAGCTTCTACTCCCAAAGCAAGAACTCCCACCCCTCCTCCCCCAAGAACACCAAGTCCCCCTCACCCTTCCCCTGATGCACTGGAAGCATTAAGACAAATAGGAGAGCTGATGGACAAACATGAAGTGATAATTGAACAAGTGGATGCTTTAGAGGAACAAATGCCCAAGAAAGCTAACCTTGAGGATTTGGATGAACTCAGGAAACGACCTGATGTTCCAGATGACATTCTTGAACAACTTAAGTGGTTACAAGATGGACTTGATGCAATTAATAAATGGAAAGACGAGAAAACCATTCCGGCTGACCTTGAATCCCAATTAACATCACTGAGGGAAGGACTGTCATTACTCAACAATAACAAGCAACAGATTGATAGTATGGGAGAGCAACTGCAAAGCTTAAAGAATGTATCTGATATGCTGAGCTACCACAATGAAAAGCTTCATATGATTCCTGATGACCTACTGGACCAACTTAATAAGCTTAAGTACTTGGAAAGAGCAACAAGCCAAATAAAAGAGTTTAATGATCAGATACCCTCAAGACTGCAGCGTATCGAGGATCGATTAAAAGAAGATACAGAACGTGAGATCAGAACTTTAAGAGATGGTCTGCGTCTTCTCAACAACCAACTAGATAAGTACAAGAAGATGAAAGAAACCCTTCCTTATTCTCTGTCGTCAAATGCCGGAAAAGTAAAGGATGGTAGCGCCCTCAGTGCTTTGAGAAGCATGCTAACAGAACTTCAAGGAGAACAGGAAAAACTTAACAACACGACAAAGGAACTTATAGAGGAACACAACAGGAAACAGAAACATATTGATGCCTTGTACACATACGCTGACAGGCTGCAGGAGGTTAAAGCTGACAAAGAACAGGTTGCCATGGAAATGGACGTGAAAGCGGACAAACGTGCGTTAGATAACTTAGTAAGTCGAACCAAATTTGACCAGAGTATAGGAGGCTTGGATCAGTCACTGCAGGAACTTTTACGTAGGCTAGAGGCACAGGAATCAACACTAAGTGATGCTCTTGCTCAGCTGGCGGGTGATATTGACCAAAAGCTTGACAGGTTGGAACTGGATCCACTCAAGGATTACCTCGAAAAGAGGATAAAGAGCATGAAATGTAAACATGTTGATTTACCACTGTCTGATGATCCTGCTGCTGGATTCCGCAAGGCATTACTCAGATTCCACTGTATTTCCTGTGACAGACCTGTTGACATGATACCTGGCCATCCCAATCCAGCTCTACCCCAGACTCCCGGTCTGCCTCCCTCCCGGTCAGGTCGTCCTTACACTACATATGAACTTGATCAAATACGTCAGATGCATCGAGGTGGGTACACATATGAACAAGAAGTAGCCACAACAACAGCCCGAGCATGTGGTGGAAGTCATACAGTGACGTTTCCTCATAGAAGGACAGCCAGATTCAATCAATATTATTACTACAAAGAGGATGACACGCCAGCAGTACCAATTCCTCAGAGGGATGAAGCAGAGCTGATTGGTCAAGATGGGCATATCTACAAAGGACGTTTTTGA

Transcript

OS493_020895-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9H0J4	Glutamine-rich protein 2 OS=Homo sapiens OX=9606 GN=QRICH2 PE=1 SV=1
Q3V2A7	Glutamine-rich protein 2 OS=Mus musculus OX=10090 GN=Qrich2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001084 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16043 all species →	DUF4795	Domain of unknown function (DUF4795)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032013 all species →	Domain	Domain of unknown function DUF4795	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47080 all species →	CHROMOSOME 16 OPEN READING FRAME 96	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_020895-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_020895-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_020895-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

46.7Max TPM

19.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.91	29.27
polyp at pH7 6	18	18	13.38	18.94
coral polyp · control treatment	16	16	22.28	39.58
coral polyp · oil and dispersant treatment	16	16	19.88	46.70
coral polyp · oil treatment	16	16	24.42	35.80
coral polyp · dispersant treatment	16	16	21.57	32.71
Polyp	10	10	19.82	43.40

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.27
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.94
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.00
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.27
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.28
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.02
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.28
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.59
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.96
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.51
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.07
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.01
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.99
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.84
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.48
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.99
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.94
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.27
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.83
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.04
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.94
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.05
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.75
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.41
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.27
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.39
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.38
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.89
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.64
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.29
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.14
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.38
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.19
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.58
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.09
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.38
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.05
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.01
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.01
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.53
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.37
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.63
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.45
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.77
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.66
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.95
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.88
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.38
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.70
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.16
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.75
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.58
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.47
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.04
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.55
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.18
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.79
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.70
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.44
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.52
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.09
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.80
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.70
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.04
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.80
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.40
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.03
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.03
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.91
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.74
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.77
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.18
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.16
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.73
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.64
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.71
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.81
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.80
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.68
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.08
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.48
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.23
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.91
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.27
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.05
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.85
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.21
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.00
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.77
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.98
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.28
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	43.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	39.25
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	21.01
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.18
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	17.17
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.77
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	11.96
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.34
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.44

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.