Gene detail

Detailed information of OS493_021173-T1 in Lophelia pertusa

Genomic Location: scaffold_80:888697...901577
NR annotation: KAJ7384542.1, Nucleolar protein 6 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_021173-T1

ATGAAGCGTAAGACGGAAGCTACAGAAGACTCTGTTGAAGTCGATAATACTCCCAGAAAGAAAGCTGTTTTGATGAATGGTGGAGGGCATCAAGCAAAGACTACAAACTACAAGGACAGTCTGTACCGACCCCCTACTAGTGAGGAAATAAATGCTCTCAAAGAAACTGAGAATCTTTTTAAGTCCAGTCTTTTTCGTATGCAGATAACTGAACTTCTCTCTGAAGTGCAACCAAAGAAAGACAGAAACAAATCTCTTGATGAAGTTTTGCATGAGCTGAATACTTTACTGCTGTCCTTACCTGATGGGAAAAAGGAACACGAGGTGGCAGATCACTCGTGGCTCCCAAGAGGAACCAAATTTCCCCTCCCCTCTACGCCTTCTCCCGTGAAAGGAAAGTTCTGTTTTCGGAGACCAGTGAGTGTTAAAGTTGTTGGAAGTTATCTCCTTGGTACAGTAACCAAACCAGACTTGAATGTCGATATTGCTGTGCAGATGCCTAAGGAATGTTTTCAACCCAAGGACTATCTGAATCTTAGATACCATCACAAGCGAGCTCTGTACTTGTGTATCATAGCATCGCATTTGACAAAAAGCTCTTTGTTTGAGAGTGTCCAATTTAGTCACATGAATGGAGAGGCGTTGAGGCCAATTCTACTCCTTAAACCTAAAGGTAAAGCTGGGAAACAGTTTGTCATCAAATTGCATCCATGTTTATCAGAGGGCACATTCAAGCCTCAGAGGTTTTCTCCAAACAGGAATAACATTAGACAGTACTGGTTCAAGGGAGAGGAAGGCGTGGCAGATGACGGCGGTGACACAGGATTACCAACTCCTCATTATAACACGTCGGTGTTGTCGGACATGTTCCTGGAGCAGCACCTCCATCACTTGTATAAAAGCATCACTGATTTTCAAGGAATGAAAGATGCTGTTGCTCTCATCAAAGTTTGGCTGCATCAACGGGAACTTGATCAGGGACAAGGTTGTTGCAGAGGATTTTTGGTGTCCATGTTTATCTCATATTTACTATCAGTTAAGAAGATCAATCAACGCATGAGCTCATACCAGATTCTTAGAGTTTTCCTACAGTTCCTTGGATCAACTGATTGGACAAAAGAAGGAATAACAATGATTAGAGAAGAGAACGAAGACAGTAATATGCCATCCAAGGCCGATTTTCATGCTGGGTTTGATGTAGTGTTTGTTGACCCCTCTGGCTACCTTAATTTGTGTGCTGGGATGACTGTGGCACAGTACAGAAGACTGCAACATGAAGCCAGGTTGTGTTTGGAATGTTTGGACAGTAGTTTTATGGATGGCTTTGAAGTTCTCTTCATGACGTCTGTCCCCTTTACACAAGCATTTGATCAGTTTTTTACAAATTCCAAATATCAACGCATTAGAAGTGGTCTGGGCCTGGGAAAGAGAGTAGAGATGCTGTGCGTTAAACCACAAGCACCCTGTCAGTGGCCTGTGAACAAAGCCCCACCCTCCAGAAGTCAGAGCAGTGTGACACTGGGCTTGCTGTTGAATTCTGATCATGCAGATACGGTCCTCGACACAGGACCCCCGGCCGACAGTACCGAGGCAACGTCTTTCCGTGCGTTTTGGGCGGAGAAAAGAACCATATGTGAACAAATTATTAAACACCTTCTTCAAAGACACGGTGGTGTTGACCCAGCATCCCTCACCTACATTGGAAGTCAGCTGGACTGTGTACTGCAGTCTCATGCCGCCGCCACATCATCTGACAGTGGAACAGGCGATGAAGAGGCTCAGAGGGTGATCCAAGTTTACAACGTTTTGTGTAAACAAATCCGTGCGCTGGAATTGCCGCTCAGTGTCAACTCGCTTCAGGGGATCAGTCCGGTTTTCAGGGGAGCAGAGGTTTTCCCGCCAAGCCCTTGCTTTAAAAACAGCAAAGTAAAGCCGCAAATTGGCGATGAAAAGTTAGCCGACAATGTGCTCCTTCCTTCTGAAATAAAGAATACGAGTTGGTGTCCAGCAATGGAAGTTGTTTTGCAGTTCGAAACAAGTGGAAAATGGCCAGATGACCTGACCGCCATTCAGCACATAAAAGCTGCGTTTCACATCAGACTCGCTCACCTGCTGAAGAGCGAGTGTTCGCTTGTAACTGCAGCTTCAGCTAAACATGTGGATGTTCTTAAGGATGGTCTTGTGTTTAGAATCAAGATCATGCATTACAGGGAAATGGTGTTGCTTCAGAAGAATGAAATCACTCAAGACCTCAAAACAGATTGCGAAAACAGAGTTAAAGAACTGGAACGGGAGATAACACATCTGCCACTCTTAACAAGCACGCTTCATGGCATACAACAGCAGTTTAGTGGATTTAGCGGAACTGTTCGTTTGGCCAAACGATGGACGTCAGCTCAACTGTTGTCTGATCACGTGACTGAAGAGTGCATTGAATTACTCGTGGCTTCTCTCTTCCTCTCCCCAGCCCCCTTCACTCCTCCAAGGTCTCATCTCGTCGGATTTCTTCGATTCCTTCGTCTTCTTTCCTCGACCGACTGGCAAACGACTCCTATCATTCTAAATTTGAATAACGACATTTCTGCGGAAGACTACCAAGAAATAACTTACAAGTTCTCACACAACAGAGCGCAACTTCCCGCCATATTTATCTCCACTCCCAAAGACAAGTTCACTTCTTTGTGGACCAAAGATAAACCTTCCAAACAGATTGTCAATAGACTTTCGTTGCTAGCGAGGGAGTCACACGCGATCTTGGTACGTCAAATTGAAACATGCGCTCTACAACCAACAGATTTCAAGCAAATTTTCCGTCCGCCATTGGATCACTATGACGTCATTATCCACCTCCACAGCCGTCTCCTCCCTCGTGGAACCCAGGCCCTTGATCACCGGAAACCTGCCATAGAACCAGCCTCGTTATCGCGTTCTTCAGTCTTACTTCCGGTCACAAACTTTGACCCTGCGCAGTTGTATCTTGAAGAACTTAAGGAAGCATTTTCTGACGTTGCCCTGTTCTTTCACGATGTTTATGGAGGGGACTTGATTGGTGTTGTGTGGAAACCTCACAGCTTTGCGCCAACTCAGTTTAAGGTCCTTCATGCACAGTACAAGATGCCATTTACCAATCCTCAAACGAGTGACAAGTCCAAACAGGTCCAGAGCTGGGTCATCCCTAATGTATCAGCCATCTTGTCTGACTTTCAAACAATCGGAGAGGGACTGGTGAAGAAGATCGAAGTGTTGAATGCGTGA

Transcript

OS493_021173-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5M7P5	Nucleolar protein 6 OS=Xenopus tropicalis OX=8364 GN=nol6 PE=2 SV=1
Q6NRY2	Nucleolar protein 6 OS=Xenopus laevis OX=8355 GN=nol6 PE=2 SV=2
Q9H6R4	Nucleolar protein 6 OS=Homo sapiens OX=9606 GN=NOL6 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003520 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17405 all species →	Nrap_D4	Nrap protein nucleotidyltransferase domain 4	Domain	Interproscan
PF17404 all species →	Nrap_D3	Nrap protein domain 3	Domain	Interproscan
PF17403 all species →	Nrap_D2	Nrap protein PAP/OAS-like domain	Domain	Interproscan
PF03813 all species →	Nrap	Nrap protein domain 1	Domain	Interproscan
PF17407 all species →	Nrap_D6	Nrap protein domain 6	Domain	Interproscan
PF17406 all species →	Nrap_D5	Nrap protein PAP/OAS1-like domain 5	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035369 all species →	Domain	Nrap protein, domain 4	Interproscan
IPR035368 all species →	Domain	Nrap protein, domain 3	Interproscan
IPR005554 all species →	Family	NOL6/Upt22	Interproscan
IPR035367 all species →	Domain	Nrap protein, domain 2	Interproscan
IPR035082 all species →	Domain	Nrap protein domain 1	Interproscan
IPR035371 all species →	Domain	Nrap protein, domain 6	Interproscan
IPR035370 all species →	Domain	Nrap protein, domain 5	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR17972 all species →	NUCLEOLAR RNA-ASSOCIATED PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006364 all species →	Biological Process	rRNA processing	Interproscan
GO:0006409 all species →	Biological Process	tRNA export from nucleus	Interproscan
GO:0032040 all species →	Cellular Component	small-subunit processome	Interproscan
GO:0032545 all species →	Cellular Component	CURI complex	Interproscan
GO:0034456 all species →	Cellular Component	UTP-C complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14544	UTP22, NOL6; U3 small nucleolar RNA-associated protein 22	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_021173-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

58.4Max TPM

5.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.00	8.04
polyp at pH7 6	18	18	5.34	7.56
coral polyp · control treatment	16	16	5.30	13.85
coral polyp · oil and dispersant treatment	16	16	3.17	6.74
coral polyp · oil treatment	16	16	4.48	6.94
coral polyp · dispersant treatment	16	16	3.95	10.47
Polyp	10	10	14.39	58.43

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.04
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.89
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.86
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.81
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.50
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.37
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.98
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.90
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.40
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.20
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.05
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.77
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.42
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.12
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.56
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.28
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.82
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.80
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.45
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.14
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.76
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.58
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.24
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.12
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.04
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.86
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.64
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.25
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.73
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.85
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.24
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.36
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.99
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.39
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.26
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.82
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.24
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.60
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.17
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.07
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.93
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.11
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.74
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.18
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.44
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.09
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.03
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.80
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.76
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.72
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.70
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.51
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.49
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.84
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.60
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.30
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.11
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.10
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.70
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.35
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.22
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.19
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.04
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.02
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.46
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.23
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.18
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.47
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.94
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.53
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.40
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.60
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.62
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.52
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.49
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.40
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.35
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.66
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.53
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.76
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	58.43
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	19.40
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	18.81
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.78
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.81
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.61
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.41
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.22
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.06
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.36

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.