Gene detail

Detailed information of OS493_021294-T1 in Lophelia pertusa

Genomic Location: scaffold_81:501574...532975
NR annotation: KAJ7378712.1, Trafficking protein particle complex subunit 11 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_021294-T1

ATGATCTGTTGTGTCCTGAGCAGGAGCAGCCTTCAAGATCAGAATACCAAAGTAGCTGTAGTGCTGATTCAAAAGAATGCACCTCTTCCACCAGGTGATGATCTACAGGCACTGGAAAGAGCAGCAACACTGTGTAGTGCTTGTGATTTGTCAGCCAAATCTCTGTTTGTCCTTCCACATACAGATCACTTGATTGGTTATACAATCAGGTTGGAAAATGCTTTCTATGACTTAGCACAAAGTTATTATCATGGAGAATGTAGAAGAGTTAAAGCACACAAGGAATTTCTTAACAAAGGAACTCATCAGTTGCTGTTGGTACGTCACCAGTTTAAGGTTGCCTTCTTCAATGAGCTGCGACAGGACCCTCATTCAGCTGTTAAACACTACAGGCAAGCCTACAGTCTCCTAGGAGAGCTCAAAACAAGTGACATCAATGTGCTAGAAATTAAAATTGTCGCAGGATTTGTCAATTATAAGATTTGTCGTCTAAGCTTCCAAGCATCCGCTCCATTAGATGCTATATCACAGTTCAGAAAACATGTAGATTTGTTCAAGGAGAAAGTTGGCTGCCCTGATCTCGCATTTGAACACTCAGCTTGGCTCTCTAAACAGTTCAGTTTATTTGGAGAACTATTTGATGAAGCCATCAGGAATGGACTGACAGCATTACAGACTCAACACCCAGGGTTCTACTATCAACAAGCTGCTAATAATGCTATTGTGAGGAGACAGTTATGCCAGGGCTTGTGCCATACTACCACTCCACTGTCCATGAATCCTTTGGAAAATGCTGGAAACTTGGACTTTTTTGGTCAGAGACCTTGGAGGCAAGGTTTTCAAGGAGCAGAACCACCGGATGCTGGAATAGAGCATGCTGGAATAATAGCATTGCAGGCTCAGGAGATACAGGTGGACCACTCATGGATCATTATTCCTCTTCTCAGCAGTGCAGTGGCTCAGTTTAAAAAGTACAAGTCACCCAGGATGAAGAGATATCTTATGGTGCAAATGGGAGAGGAATATTACCATGCCAGAGATTTTAGCAAAGCTTTAATGTTGTTGGGTAGAGTCACTTGGGATTACCGCAGAGAAAAATGGTGGTCACTTCTTACCTCAGTGTTAATCACATCACTAAGGTGTGCTTACCTGGTTGGGGATATGCAAGAGTACATCACCCTTTCACTTGAATTGATGGGAAGATATGTTGAAAATTCACCTGAAGAGAAAACAAGATGTCAGACAAACCTCATTCAAGTTATGTCGAATGAATGTCCTGAGCCCGAGCCAGGCTGTGACTTTGACGCAGTGGAAGAAGCAAAGGAATTGTGGAAGACACTGAAGGTGACGCCACAGACACCCCAAGTATTTACCATACAGATGGAACAAATAGCACCGTTTATTGAATGCAAAGCTGTGTTTGATTCGTTTACAACCACAGCAGATTCTACCATCCTCCTTCAAATTTACTTGAGGGTGACCTGTCCTTTTCCAATCCGTTTTTGTAAGATTGCCGTTTTCTTCAGCAATCAGTTTTATAACCAGCAGTGTGTCGTGGAGACTGGATTAATCCAAGGAGAGGGTGGACTGTATCTCCTCCCAGCTAAGACTAAAGTCATTCCGTTCCAGCTTGTTCCACAACCAGAGGATGTTGGAAAACTACTTCAGGTCACCTCTGTTGCTCTGGAGCTGGGTTCCCGTGAGTCTCGGTGTGCTGTGCTAGTGTGGAGTGGTTGGGGAGGGGAGACTGCCATTGTCAACAACTACTTTGTGAATTACGGCTTAAAATCCGCCTCCAAGGAGGATCAGATTGATTGGGATGATTTAAAGATTGTCTCAAAAATCAAAATTGAACCACGCAAGCCTCAAATTGACATTAAACTCAAGCATGAACCACCGGCCCTGGTGAACGAGTTTTATGAGCTTCAATTGGTTGTTGAAAGCTTGGAGGACACACCCGTGAAAGATCTCAGAGTCTGGTTGGGATTTCAGGACGAGCATGAGTCTGCGGAGAATGCCGCTTTGATTTACTCAGAAGTACCAGCAGCTCATCAGGCTGTAGGACAAACAAAGAGCTTCATTGAATTCACAGTGAAAGAAACAAACCAAAAGATCGAGAGGTCTTACTTCGTTAAGTGTTCTCAAGTTGGTTCACGGACTGTAACAGCAAAGATTACTTATTCGGTGGACGTCCAAGTAGAACCCAACTCTCCGCCTGTCACTTGTACTTGTGTTAAGGAGGACAGTGTTGTTATCGAGATTGTGATGCCATTTGAAATATCTCTGTCGCTGACAAACCTTAAGCTGGAAAGACTGGACCAAGTGTTTGAAGAGGAACCATTTCTGTTATTGGCTGGGATCAAGTGCACTTCACCTTGGCCTGTTACCATGGTTACTACCACTCTAAATATGTCTCCAGAAGTTGGTATTGTTGGAGAAGAGATGGGATCACAGCTACAAGGATCTCTTTGCAGCAGGTGGAGACGAACTTCTGCCGCTGATGAGTTTCCGGTTGTGATCACAGAACTTACATTTCCATCTGTCACTGTGGAAAGTGTACCTTTTGCCATCCAAACAGATTTGCCCGCATATGGCTGTGTACAGACTCCTCTGTCTGTGAGCTATCTCGTCCGCAATAGAACGCTTCAGGTTCAGGAAGTCGAGGTGACAGTGGAGCCAAGCGATGCTTTCATGTATGCAGGTCATAAACAGATTCAGTTTCGTCTGCTGCCCACTGGTGATCACAGGCTCAAGTTCAGTTTGTACCCTCTTTGCGCTGGCTTTGTAACCCTTCCCAAGTTGCATTTCAATCTGCCTCGCTTTCAGGTTAGCTGGGATGAGCACGCACAGAAAATGGTTCCATCCAATGTTTTTATCAAGCCAAGAGGACGGGAACTAGGCTCATGA

Transcript

OS493_021294-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZI89	Trafficking protein particle complex subunit 11 OS=Gallus gallus OX=9031 GN=TRAPPC11 PE=2 SV=1
A6QLC7	Trafficking protein particle complex subunit 11 OS=Bos taurus OX=9913 GN=TRAPPC11 PE=2 SV=1
B2RXC1	Trafficking protein particle complex subunit 11 OS=Mus musculus OX=10090 GN=Trappc11 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003086 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12742 all species →	Gryzun-like	Gryzun, putative Golgi trafficking	Domain	Interproscan
PF11817 all species →	Foie-gras_1	Foie gras liver health family 1	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR025876 all species →	Domain	Trafficking protein particle complex subunit 11, C-terminal	Interproscan
IPR021773 all species →	Domain	Trafficking protein particle complex subunit 11	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14374 all species →	FOIE GRAS	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_021294-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20308	TRAPPC11; trafficking protein particle complex subunit 11	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_021294-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

33.6Max TPM

14.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.75	19.90
polyp at pH7 6	18	18	14.69	19.68
coral polyp · control treatment	16	16	16.08	25.80
coral polyp · oil and dispersant treatment	16	16	11.51	17.56
coral polyp · oil treatment	16	16	16.15	21.09
coral polyp · dispersant treatment	16	16	11.56	21.57
Polyp	10	10	18.94	33.64

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.90
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.65
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.80
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.49
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.28
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.79
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.09
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.96
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.28
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.43
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.31
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.35
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.72
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.56
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.14
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.68
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.62
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.03
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.85
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.41
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.11
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.92
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.73
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.70
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.60
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.10
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.76
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.09
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.75
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.80
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.55
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.31
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.46
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.42
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.10
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.60
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.57
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.33
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.56
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.86
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.30
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.70
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.56
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.20
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.33
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.61
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.40
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.82
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.48
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.59
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.05
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.41
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.33
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.37
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.69
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.09
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.93
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.75
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.12
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.04
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.76
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.28
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.86
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.26
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.27
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.04
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.79
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.62
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.57
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.28
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.91
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.59
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.57
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.24
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.66
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.33
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.23
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.66
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.55
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.05
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.11
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.99
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	33.64
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	32.54
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	22.04
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	21.40
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	20.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	20.69
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.90
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.39
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.26
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.73

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.