Gene detail

Detailed information of OS493_021305-T1 in Lophelia pertusa

Genomic Location: scaffold_81:684509...699680
NR annotation: KAJ7378723.1, Transcription elongation factor SPT6 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_021305-T1

ATGAGAGAAATTGATGAGTCTCACCCCTGCAGTACGTTAAAGTACATTAAACACAAACCAGTCACCGACCTTAAAGGAGATCAGTTTCTGCGCATGTGTAAAGCAGAAGAGGATGGATTACTCACCATAAGCATTGGAATCGACCTGGACAATAGTGTAGGATACCAGACTTACTTTGATGAAGTCAAGCAGTTGTATTACAGGGATGAGTTTAGCCATCTAGTTCAAGAATGGAACACACAAAGAATGAATGCTTTGTCACGAGCCTTCACCCAGATGCTGTATCCACTTCTTGAAAAAGAACTTAAGCTCAAACTCATTCAGGAAGCCAAGAATTTTGTTGTGAAGTCATGTTGTCGCCGATTGAGGTCATGGATTGAAGTTGCTCCATATCAACCCGAGCAGCATGTTGACGACCAAGACTATGATGACAACACTAACTCTGAGGGGCTCCGTGTGTTGGCGTGTTCTATTTCAGCCAGTCCAGACACACCAGCTTTCCTGGCCATGCTGGACGGAGGAGGGCAAGTAAACGACTATCTCCGGTTGAAGTATCTTCTGAACAGAAGAAATACAACTAGAGCTAAAGAACGAGAAGACAAGGAAAAGGACCTGCAGAGATTGAAGCAGTTTATACTCAAGAAGCGTCCTCAGGTTGTGGTTGTCGCGGCGGAATGTCGCGAAGCTGTTGCTGTGGTGGATGACATGAAAATGTGCATATCAGAGCTTGAGCAAGAGAATCAGATCCCATCCATCTCTGTAGAAGCACTGGATGGTGAAGTGGCTCGTGTGTTCATGTCTTCTCCTCGATCTGAGAATGAGTTTCGTGAGTACCCTTCCCTCCTGCGTCATGCAGTGTCTCTTGGCCGCAGGATTCAGGATCCGATTACAGAGTTTGCGGCTCTGTGTATTGAGGAAGATGAACTTCTTTGTTTACGACTGCATCCATTCCAGGACCATGTATCCAAAGAGTGTCTTGTAAAGAACCTCCATCAGGAATTCGTGACACTTGTAAATGAAGTAGGTGTTGACCCCAACCGTCTCTTGGAGCATCCACACACAGTGGCGCTGTTGCAGTTTGTGTGTGGACTGGGACCTAGAAAAGCGTCCTCCTTATTAAAGAGTCTACGTCAGCAGTGTACCAGGCTCGAGAACCGCTCTCAGCTTGTGACCGTGTGTGGCCTGGGTCCTCAGGTGTTTCTCAACTGCGCAGGCTTTATTAAGATCGATACAGCAGCCATCAGTGACACGACCACGAACTACATCGAGGTGCTCGACGGCTCACGAGTTCATCCGGAGACCTACGAGTGGGCTAAAAAGATGGCCGTTGACGCACTCGAGTACGACGAGGCGACCATGGAGTCCAACCCGTCCTCTGCTTTAGAAGAAATTCTTGAGGCCCCTGACAGGTTAAAAGATTTGGATTTAGACGCGTTTGCCGAAGAGCTTGAACGCACGGGATTCGGAAACAAGCGGATAACATTGTACGACATCCGAGATGAGCTGTTTGGCCAGTATCGGGAACGTCGCTCACCGCACCGTTCACTTACGGTAGAGGAACGCTTCAGACTGCTGACAGGTGAGACCAATGAGTCTCTTTACGTTGGCAAGATGGTGGTCTGCACTGTGACTGGCTTCGCTAACAGGAAACCGCCGCGTGACATGATCGACCAGGCCCAGCCTGTTAGGAATGACGAGACTGGCCAGTGGCAATGTCCGTTCTGTTTACAGGATACCTTCCCTGATCTGAGCGAGGTGTGGACACATCTCGATAATGGAAGCTGTGCTGGCCAGGCGGTTGGTGTTCGCACCAGAATGGAAACTGGCCTTTCCGGGTTTATTCCTACCAAGATGATAAGTGACAAACACATCAGTAGCCCTCACGAGAGAGTCAAGGCGGGAATGACGCTTCACTGTCGCGTGACGCGTGTAAACATGGAGCGATTTCAGTTGGACCTCACATGTCGCTCATCAGATCTCGCAGATAAAGAAGAAAAATTCAGTCTTCCTAAAGATTTGTATTACGACCAAGATGCGTCAGACAAAGACAAGAAGGACGAGGATGCGGCGAAGAAAAAAGCCAACAGACCAAAATACGTAAAACGTGTGATCGTACATCCGGCGTTCAAGAACATCTCATTTAAGGAGGCCGAGAGGCTGTTAGCTGAAATGGATCAGGGAGAATGTATTGTCAGGCCCAGCAGCAAGGGCGCTGATCACCTGACTGTCACGTGGAAGGTTGATGACGGAGTTTACCAGCACGTGGATGTACGCGAGGAAGGAAAAGAGAACGCGTTCAGTCTCGGCCGATCACTTTGGATTGACAGCGAGGAATTTGAAGATCTTGATGAGATCATTGCCCGACATGTTCAGCCAATGGCTTCATTTGCTCGAGAAATTCTCAACCACAAGAACTACAGAGCGGTGGACGGCCTCAGATCTAAGCTGGAAGAGATTCTTCTTGTGGAGAAAAGGAAAGCACCACAGAGAATCCCTTACCTTATGAGCACGACCAAGGAATTCCCTGGGAAGTTCTTCCTGGGATATCTTCCCCGCGTCAAGCCCCGTGTGGAGTACGTCAGTGTGACCCCGGACGGATTCCGTTATCGAGGAAGAGTACACGCCACGTTAAATGGCCTGTTCAGGTGGTTCAAGGAGCACTTCAGGGACCCCATACCAGGTACTCCTCGTCATAGAGTGCCAGTCGCCATGTCGGAGAGCAACACTCCCTACACCCCAGGGGGTACCCCCTCCATTAACTCTGACGTTGACCCCGCCCGACTTTTACCCCAGCTTCAGCAGCATTTCCCTCGGGGAATCACCGACCCCAAGGTTTACTCGGCGCTTGCTGCAGTTGCTAGGCAACAGCAACAACAGGAGTCGCAAAAGAAGACAACAACCACACAGCTTACGCCTGCGCAGTGGGGTGCGGCCGCAGCCCAGCATATACAGCGTCAAAACAAGCAGCGGGCTCAGCTTCAGCAAACGCCTACACAACAGACCCCGACACAGCAGACCCCGACACAACAAACACCGACACAACAGACCCCGACACAACAGACACCGACACAACAGGGATACCAGCAATTTCCACAGTACGGCTACTACCAGCAGCACCAGGATCAAACTCAAACCCAGACTCCAACTACCACTTACGGATACCAGCAGACATACACTGGCGGCAAGACGACTGGAAACGAGAATAGCAAGAGTCGGTAG

Transcript

OS493_021305-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8UVK2	Transcription elongation factor SPT6 OS=Danio rerio OX=7955 GN=supt6h PE=1 SV=1
Q7KZ85	Transcription elongation factor SPT6 OS=Homo sapiens OX=9606 GN=SUPT6H PE=1 SV=2
Q62383	Transcription elongation factor SPT6 OS=Mus musculus OX=10090 GN=Supt6h PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003299 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14639 all species →	YqgF	Holliday-junction resolvase-like of SPT6	Domain	Interproscan
PF17674 all species →	HHH_9	HHH domain	Domain	Interproscan
PF14635 all species →	HHH_7	Helix-hairpin-helix motif	Domain	Interproscan
PF14633 all species →	SH2_2	SH2 domain	Domain	Interproscan
PF00575 all species →	S1	S1 RNA binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037027 all species →	Homologous_superfamily	YqgF/RNase H-like domain superfamily	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR023323 all species →	Homologous_superfamily	Tex-like domain superfamily	Interproscan
IPR010994 all species →	Homologous_superfamily	RuvA domain 2-like	Interproscan
IPR042066 all species →	Homologous_superfamily	Spt6, Death-like domain	Interproscan
IPR036860 all species →	Homologous_superfamily	SH2 domain superfamily	Interproscan
IPR028231 all species →	Domain	Transcription elongation factor Spt6, YqgF domain	Interproscan
IPR041692 all species →	Domain	HHH domain 9	Interproscan
IPR000980 all species →	Domain	SH2 domain	Interproscan
IPR032706 all species →	Domain	Transcription elongation factor Spt6, helix-hairpin-helix motif	Interproscan
IPR035019 all species →	Domain	Spt6, SH2 domain, N terminus	Interproscan
IPR017072 all species →	Family	Transcription elongation factor Spt6	Interproscan
IPR035018 all species →	Domain	Spt6, SH2 domain, C terminus	Interproscan
IPR035420 all species →	Domain	Spt6, SH2 domain	Interproscan
IPR003029 all species →	Domain	S1 domain	Interproscan
IPR012337 all species →	Homologous_superfamily	Ribonuclease H-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10145 all species →	TRANSCRIPTION ELONGATION FACTOR SPT6	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006139 all species →	Biological Process	nucleobase-containing compound metabolic process	Interproscan
GO:0140673 all species →	Biological Process	transcription elongation-coupled chromatin remodeling	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0006368 all species →	Biological Process	transcription elongation by RNA polymerase II	Interproscan
GO:0008023 all species →	Cellular Component	transcription elongation factor complex	Interproscan
GO:0031491 all species →	Molecular Function	nucleosome binding	Interproscan
GO:0034728 all species →	Biological Process	nucleosome organization	Interproscan
GO:0042393 all species →	Molecular Function	histone binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11292	SUPT6H, SPT6; transcription elongation factor SPT6	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_021305-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

48.7Max TPM

26.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	23.56	37.38
polyp at pH7 6	18	18	24.22	32.94
coral polyp · control treatment	16	16	30.63	43.82
coral polyp · oil and dispersant treatment	16	16	32.24	48.73
coral polyp · oil treatment	16	16	27.30	35.03
coral polyp · dispersant treatment	16	16	25.61	37.81
Polyp	10	10	15.09	21.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.73
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.78
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.57
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.06
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.75
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.99
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.09
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.64
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.15
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.63
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.57
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.30
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.78
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.64
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.04
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.94
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.60
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.32
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.69
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.68
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.32
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.70
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.33
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.45
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.96
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.40
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.26
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.00
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.27
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.73
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.82
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.40
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.91
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.76
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.67
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.40
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.24
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.90
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.05
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.09
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.20
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.78
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.41
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.64
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.48
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.26
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.73
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.66
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.08
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.50
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.69
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.87
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.78
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.41
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.14
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.68
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.49
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.26
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.05
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.82
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.38
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.03
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.01
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.25
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.52
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.25
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.84
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.14
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.83
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.43
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.33
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.11
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.84
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.33
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.27
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.81
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.62
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.15
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.34
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.22
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.24
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.08
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.87
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.25
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.44
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.39
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.67
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.86
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.64
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.49
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.94
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	21.05
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	19.35
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.33
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.03
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	15.47
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.20
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.02
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.36
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.13

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.