Gene detail

Detailed information of OS493_021688-T1 in Lophelia pertusa

Genomic Location: scaffold_84:777279...791980
NR annotation: KAJ7330759.1, RNA binding [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_021688-T1

ATGGCCAGCGCTAATCTACAGAGATTACCCAGAGCTGCTTCAGTGTTAGCAGAAAACCTGAACCTAGGCGTGGGAGTTGTTCGTACGGTCATTACTTTACTCGATAAAGACAACACCGTACCGTTCATAGCTCGCTATCGTAAAGAGCAGACTGGAGGACTGGACCCCACAGTACTGCGGCATATTCAGGCTCAGTATGAACAGCTCAAATCTATCAAAGAACGTGCCGAGTCAGTCAGTAAGAAGATAGGTGAGAAGCTTACACCGGAAATTAAAAATTCCCTCAACAATGCACTCACCATGGAGGAGGTGGAAGAAGTGTATGCCCCATTCAAGAAAGGTAGTAAAGGATCACATGCCGAGAGAGCGCGACAGCTTGGACTTGGTGAACCTGCTGAGCTCTTGTTAAAGAATCCCAGGAATGTTCAGCTTGTAAAGCTGGTGAAACCTGATACAGAAGGAATCAAAGATGTGAAACAAGTCTCTCTTGGCATACAGCACATTCTGGCAGATGTGATTGCCAAAGACAGTTCCACTTTAAGCTCAATTAAGGCAACGTTGGAGAGAAATCCAGTTCGCATTGAGTCGTCGCTGTCTCGTTCAGCCACAAAGGAAAAGAAAAAAGGCGGAGGAGACAAAAAATATGAGCAGTACCACGGCTTCAACATGCCAGTTTCTTCACTTAAAGCACATCAAGTGCTTGCTTTAAACAGAGGTGAACAGAATAAGGTTCTCTCTGTTAAACTGACTATTCCTAAACCTGTGGAAGGCCAGTTTCTTTCTCATCTCCATAAAACATGGGTTCCCTGTGACGCTCCAGGACAGATACAAAAACTGTTTAGAACAGCAGTGGACGATGCATATAACAGACTTATTAAACCAAAGATCACAAGACAGTCCAGGTCTTCATTGACCAAACAGGCTGAAAAAGAAAGTGTCGACTTATTTATGATGAACCTGTATCGCCTCCTCCTCACCCCTCCCATGAGGGGGAAAAGTGTTCTTGGTTTAGACCCAGGCTTCTCTCATGGGTGCAAATTAGCGGTGCTAGGTTCCACGGGCGAGGTTCTTGAGACAAGGATGATCTTTCCATTTGGAAAGAATGCAAATGTTGGACAAGCAAAAAACACAGTGGTAGACCTTGTTTTAAAACACAGTTGTGAGTATGTAGCTATTGGGAATGGTGTTGGATGCCGGGATGCCGAAACATTCATAAGTCAGCTCATCAAACAGCGAGAGCTTGCTCCACTTGACATAGCTTATTGTATCGTCAGCGAGGATGGAGCCTCTATTTACAGTGCGTCTCCAGAAGCAGCAGCTGAGCTGCCAAGCCTTGATACAAGCCTCAGGGGAGCTGTATCGATAGGACGGAGACTGCAGGACCCTCTGGTGGAACTAGTGAAGATTGAACCTAAGCATTTGGGTATTGGCATGTACCAGCATGATATCCCCGATTCGTTGCTCCGAGGAGCTTTGGACGGTGTTGTGGAGGATTGTGTGAGTTTTGTTGGAGTTGACTTAAATGTAGCAGGAGTCAGCATGTTAAGGCGCATAGCCGGTTTAAATGACAAGAAAGCAAAAGCGATTTTAACATGGCGGGAAGAAAATGGCGCCTTCACCAACCGCGAGCAGCTGAAGGCAGTGAAGGGGATTGGGCTCAAGTCTTACGAACAATGTGTTGGGTTCGTCAGAATAATGAACAATTCACGTCTCCATAGCAACGCTGCTAGACCATCCGCCAGCGGACAGTGCAGTACAGCGGATAACAACAGCAAGGCAGAGATTGTTGTGTTAGATTCTGACGAGGAAGTAAAGATGGCGGCGCGTGGAAGGAAAAGAAAGGGAGAGAGCGCCGAGGAAGAAGTAAAGAAGAAGAAAAAGAAGAAAGCTGCTGGTAAACAAGAGTTTTGTCCTGATCCATTGGATATGACGTGGATTCACCCAGAATCTTACCCAGTGGCGAAAAGTGCCATGGAGATGATGGGAGTTCTGCCAGAACAAATTGGACAACCACTGGTGAAAGCTGCAATCGACGGGTTTCTACAGACTCGCAAAATTGAAGAGTTAGCGGGCAAGTTCAGCGTGGGTACTCCCACTTTACAACATATCATCGACGGCCTCAGACAACCAACGGATCACGACATACGAGTCAATTTCCAGAAGCCTTTGTTCAAACGGAACGTGACGTCACTAGAAGACCTTCGTCCGGGAACCCAGCTAAGCGGCCGCGTCACGAATATGACGTCATTCGGGGCATTTGTGGACTGTGGTGTGGGACGTGATGGCCTGGTACATAACAGTAATATGGGACGATTTAAAGGCAGAGTAGGCCTGGGAGATCTTGTGGAAGTCACTGTTAGAAATGTGGATATCGCCAAACAGCATATCAGTCTGATTTTAAAGGACATATCTTCAGCGTTTAATCCACAATTGCTCGTCTCTGTAGGAACTTTATCACAAACGTGCGCGTGA

Transcript

OS493_021688-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8N5C6	S1 RNA-binding domain-containing protein 1 OS=Homo sapiens OX=9606 GN=SRBD1 PE=1 SV=2
Q5RDI0	S1 RNA-binding domain-containing protein 1 OS=Pongo abelii OX=9601 GN=SRBD1 PE=2 SV=1
Q497V5	S1 RNA-binding domain-containing protein 1 OS=Mus musculus OX=10090 GN=Srbd1 PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003648 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16921 all species →	Tex_YqgF	Tex protein YqgF-like domain	Domain	Interproscan
PF00575 all species →	S1	S1 RNA binding domain	Domain	Interproscan
PF09371 all species →	Tex_N	Tex-like protein N-terminal domain	Domain	Interproscan
PF12836 all species →	HHH_3	Helix-hairpin-helix motif	Domain	Interproscan
PF17674 all species →	HHH_9	HHH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR023319 all species →	Homologous_superfamily	Tex-like protein, HTH domain superfamily	Interproscan
IPR037027 all species →	Homologous_superfamily	YqgF/RNase H-like domain superfamily	Interproscan
IPR010994 all species →	Homologous_superfamily	RuvA domain 2-like	Interproscan
IPR032639 all species →	Domain	Tex protein, YqgF-like domain	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR012337 all species →	Homologous_superfamily	Ribonuclease H-like superfamily	Interproscan
IPR006641 all species →	Domain	YqgF/RNase H-like domain	Interproscan
IPR003029 all species →	Domain	S1 domain	Interproscan
IPR050437 all species →	Family	Bacterial ribosomal protein bS1	Interproscan
IPR023323 all species →	Homologous_superfamily	Tex-like domain superfamily	Interproscan
IPR018974 all species →	Domain	Tex-like protein, N-terminal	Interproscan
IPR041692 all species →	Domain	HHH domain 9	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10724 all species →	30S RIBOSOMAL PROTEIN S1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006139 all species →	Biological Process	nucleobase-containing compound metabolic process	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0003735 all species →	Molecular Function	structural constituent of ribosome	Interproscan
GO:0006412 all species →	Biological Process	translation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_021688-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_021688-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

13.4Max TPM

3.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.19	7.86
polyp at pH7 6	18	18	4.03	7.75
coral polyp · control treatment	16	16	2.81	6.23
coral polyp · oil and dispersant treatment	16	16	1.70	5.78
coral polyp · oil treatment	16	16	3.16	5.56
coral polyp · dispersant treatment	16	16	1.97	4.91
Polyp	10	10	6.56	13.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.86
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.31
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.71
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.01
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.02
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.46
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.27
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.20
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.96
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.32
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.07
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.82
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.80
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.77
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.45
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.35
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.11
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.75
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.90
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.50
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.56
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.15
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.89
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.88
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.74
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.52
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.13
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.69
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.66
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.99
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.66
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.23
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.51
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.35
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.15
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.38
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.82
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.33
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.32
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.77
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.59
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.55
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.47
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.44
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.38
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.83
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.41
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.41
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.92
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.47
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.39
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.38
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.93
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.92
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.80
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.65
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.56
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.46
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.10
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.71
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.17
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.64
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.95
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.34
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.15
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.11
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.90
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.80
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.91
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.84
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.53
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.27
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.97
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.45
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.00
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.85
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.82
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.24
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.17
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.37
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.39
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.79
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.81
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.98
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.78
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.12
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.92
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.