Gene detail

Detailed information of OS493_021957-T1 in Lophelia pertusa

Genomic Location: scaffold_87:988229...1048422
NR annotation: KAJ7378655.1, Nrd1 complex RNA-binding subunit [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_021957-T1

ATGTCAACAACAGATGATGAAGATAACAGCGAAGACCTTGCGGGGGAGAGTGATGATGATGATGATGATAATGACGATGATAATGACGATGATGATGGAGTCGTAAGTGGGGATCCTGATGGAGAACAAGAGAATGATAGTGAAAAATCAAGAAAACCAAAAGATACAAAGCTATCTGCCGCAGCTCTTTGTATTGGTGCTGGTAGTTTCTCTGATCCAGATGATATTCCAGGATTAGCTCACTTCTTAGAACATATGGTTTTTATGGGCAGTGAAAAATATCCCGATGAAAATGCCTTTGATGCTTTTATTAAGAAGCACGGAGGATCTGATAATGCTTCTACTGATTGTGAAAGGACTACCTTCCTCTTTGATGTTAGACGGAAGTACTTCAGAGAAACTTTAGACAGGTTTGCTCAGTTCTTTATTTCTCCTCTTCTTAAAGAAGACAGTGTTGACAGAGAAGTACAAGCAGTGGAGAGCGAATTTAGAATGAGCTATCAGAGTGACTCTGTGAGGAAAATGCAGCTACTAGCTCTACTGACTGAAAAAGGCCATCCATTTGGAAAATTTCTCTGGGGAAATGAAGAGACACTACAAAAAATTCCTAAAGAAAAGGGCATAGATGTGAATAAATCTTTGAGAGATTTTCAGAAGAGAATGTACTCTGCACAGTACATGTCACTGACTGTGATATCAAGAGAGTCTCTCAACAGTCTTGAAAAGATGGTTAGAGAATCTTTTTCCAAAATCCCCAATAACTCACAACCAAAACCAACTTTTCAGGAGTATACAACCCCTTTTGATGATTCAAAATTCCATAAAATGTACAAAGTGGTTCCAATCAAGGATGTACATCAGCTAGAGATAATGTGGATTCTGCCTCCACAACAACAGTATTACAGAATCAAACCAATGCATTATATATCCTGGTTGATGGGACATGAAGGACCAGGAAGTATTTTGTCACTATTGATAAAAAAATCCTGGGCTTCCAGTTTGCTCTGTGGCAACGGAGAGTCTGGCCAAGAACACAACACTAGTTTTGCACTTTTCCCATGCTTGATTAGTCTAACAGATGAAGGCATGGACCATATTTATGAGATTTTGACTATTGTGTTTCAATACTTGGAATTATTAAGACAAAATGGACCACAGGAGAGAATATACAAGGAACTTCAGACCATTGAGAATAACGAGTTCAGATTTCGTGAACAGTGTGAGCCTTATGACTATGTAGAGGATCTTGTGGAAAAACATGCAGAAGAAGATTATTTAACAGGAGATCAACTCATGTGGGAATTCAATGGAGAGGTTATTCAGAATGTCCAAAACAGTCTTACACCAGACAGGGCCAATATTTTGCTCTTATCAAAGAGGTGCCAGGATGAATGCACTGATTACGAGCCTTGGTTCCAGACACCTTACAACTGTTCTGATATTGATCCACAGTGGCTTGAAAAATGGAAAAATCTTGAATTAAACCCAGAACTCCATTTTCCTGAAGAAAACAAATTCATAGCAACTGACTTCGACATCAAAGATTTTGACCGCACAGTATGCGAGTTTCCAGAACTAGTCCATGATTGCAATCTCGGAAAGGTGTGGCACTCAAAGGATACGAAATTCAAAACACCACGAGCCAGGTTTTATTTCCACCTCATATCACCAGTTTTAAATGCTAGTCCTGAGAGCATGGTTCTTTCGGACCTTTTTCTGAGTGTGTTGGAGTACAACTTGAAAGAAATTGCCTACGCTGCTGATGTAGCTCAGTTAGGTTACTCCATGACAGTTAGCGAAACAGGAATTGTTCTTAAACTGGAAGGGTTCAACCACAAGTTAGCGCTTTTGTTTGAGACCGTCATCGATCACATGGCAAATTTTACTGTGACCTCTCAGACGTTTGAGATGGTCAAGCGTAAGTTAATGAGGTCATACCGCAACTCGATCATCAAACCACAGAAGTTGGTCAGGTCTGTCCGTCTATCCATCTTACAACACGTCAAATGGACAACTGTCGACAAACGGAGCGTCATTCCAGATGCCACAATGGAGACTCTTCAGCATTTTGTATCCTGTTTTAAGTCCAAGTTATTTGTCGAGAGCTTAATTCAAGGAAATATAACTTCGCAGGAAGCAGTCTCTTTACAGGAACAGTTGTACAGTAAACTGCAGTTTATGCCACTAAGCAGTTGTCTTCATCCTGAGATCCGAGTGATACAGTTGCCACAAGGTGAATGCATCTGTCGTGTGATGGGATTTAACAAGGAGGATGACAATACTATCGTTACAAACTATTACCAGTCTGGTCCGGCTACTGTTGAAGAATTCACTATCATGGACCTTTTACTGATGCAAATGGATGAACCGTGTTTTGATGTCCTTCGCACTCAAGAACAACTTGGGTACTCTGTTTTCTGTGCTTGCAGAAATACATTTGGAGTTCTTGGATTTTCTGTTACTGTTCAAACACAAGCGGGAAAATTCAGTGCAGAACATGTGGAGAGTCGAATCGATGCATTTTTAGATGCATTTGGTGAAATTTTACGTTCCCTAACAGACGAAGACTTCAAGAGTCAGGTGGACTCGCTTATTGAGCTGAAGGAACATGAAGATCTTAGTCTGGCAGATGAAGCGGACAGAAACTGGACTGAAGTTCTGGATCAGACTTACATCTTTAACAGGAAACGGCGAGAGGTGGACTGCTTAAGAAAACTGAGTAAAGAAGATCTTTATCAGTGGTTCTTGTCGCACAGGAAAAGTGGCGATAAATACAAGAAGCTAAGTGTTCAGATCATTGGGTCAGGGCAGTGCGAGACACACGCCTGCGCAGATACTCCTGTGGACGCGGACAGCGGCCTGGGTAACGATGATGATTGGCAAATCCGTCCTATACCAGTTGACACTTCCGGCAGTCAGATCTTCTGCATTAAAAACATTTCAGAGTTCAAAAGGACGAGGGCTATTTTCCCTGTAGTCAAAATTAAGTGA

Transcript

OS493_021957-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BHG1	Nardilysin OS=Mus musculus OX=10090 GN=Nrdc PE=1 SV=1
P47245	Nardilysin OS=Rattus norvegicus OX=10116 GN=Nrdc PE=1 SV=1
Q5R4H6	Nardilysin OS=Pongo abelii OX=9601 GN=NRDC PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001201 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00675 all species →	Peptidase_M16	Insulinase (Peptidase family M16)	Family	Interproscan
PF05193 all species →	Peptidase_M16_C	Peptidase M16 inactive domain	Domain	Interproscan
PF16187 all species →	Peptidase_M16_M	Middle or third domain of peptidase_M16	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011765 all species →	Domain	Peptidase M16, N-terminal	Interproscan
IPR011249 all species →	Homologous_superfamily	Metalloenzyme, LuxS/M16 peptidase-like	Interproscan
IPR007863 all species →	Domain	Peptidase M16, C-terminal	Interproscan
IPR001431 all species →	Binding_site	Peptidase M16, zinc-binding site	Interproscan
IPR032632 all species →	Domain	Peptidase M16, middle/third domain	Interproscan
IPR050626 all species →	Family	Peptidase M16	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43690 all species →	NARDILYSIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01411	NRD1; nardilysin	EC:3.4.24.61	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_021957-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

36.6Max TPM

13.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.20	19.09
polyp at pH7 6	18	18	13.61	23.40
coral polyp · control treatment	16	16	14.35	26.81
coral polyp · oil and dispersant treatment	16	16	10.51	13.72
coral polyp · oil treatment	16	16	13.81	17.61
coral polyp · dispersant treatment	16	16	9.67	17.65
Polyp	10	10	18.26	36.58

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.09
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.82
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.63
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.61
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.35
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.03
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.58
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.46
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.35
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.30
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.83
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.62
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.97
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.79
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.73
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.42
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.40
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.76
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.77
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.60
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.44
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.23
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.11
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.94
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.91
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.81
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.22
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.30
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.98
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.85
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.81
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.85
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.19
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.06
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.38
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.68
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.88
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.85
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.45
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.89
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.48
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.39
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.18
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.72
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.38
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.32
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.99
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.60
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.23
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.85
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.11
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.40
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.33
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.54
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.35
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.82
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.25
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.61
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.60
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.21
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.99
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.56
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.45
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.76
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.31
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.79
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.51
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.03
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.59
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.18
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.10
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.83
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.65
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.45
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.16
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.90
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.37
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.26
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.98
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.87
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.99
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.66
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	36.58
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	35.12
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	24.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	17.94
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	15.51
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	14.67
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.68
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.04
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.21
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.55

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.