Gene detail

Detailed information of OS493_022231-T1 in Lophelia pertusa

Genomic Location: scaffold_90:684716...687916
NR annotation: KAJ7330616.1, hypothetical protein OS493_022231 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022231-T1

ATGTCGGAAGCGAAGACATTGACGCACAAGCATGGAAATTTATGGGGTACAACAACACTGCCAACAGTGTCATCAAACGATTTGAACGAAATCGAATTCAGTTTTGATGAGCGCTCTTCGGGAACGAAATCGGCGGTTACAGTGCACGGCGCAAGCAAAATGGAAGAGAGAACACAACAAATTGGACAAAGGACGTTAACTCCTGACATAGTCGCAAGGATACAAGCGATAGACAACGAAGACGAGATCGCCACTATCCAAAGAGATATAACAACGAACACAAAGATTCCGCATTCAGCCGGAAACCAGCTCAAAGCGGAGTTATTAGCAACCGGCGACTTGTCGAGTCACGCAGTTGAAATGAAAGATGGCGAAAGGTTAGACGAATCGGGGAGGTATATTCTACGCAATGTGGTGATAATTAAACACTCTGCGTCGCCGCTTGGGTTTTTTATTCGACAAGGAGATGGTTTATTCAAGAAGCAAGGTATATTTGTTTCGCGTGTTACGCAAGGGAGCATTGTGGAGGCGAATGGACTGCTCAAAGTCGGAGATGAAATCCTTGCAGTGAATCATGTCGATATTAATGGCTTCAACTTGGACGATGTTGTGAGAATGATTCAAATTCCGCGAAAACTGGTTTTGACAATCAGGAGAACTGCTTTCTTAATTAAACAGAGTCCGTCTGTTGAAGACGCATACGATTCTATAGCAACGAAAATTAATAAAAAGTCAGGGATGTCAAAAGCTTTTAAAATCAAAACTAAAGACTCTCGTGCAAATGACTACAAAGAACCCAGCAACGAAGGTAAACATACTCTACAAACACAAACGGAAAATGTTAAAGTGGACAAAAATGTAAATGAGCTTCGAGACTTTTCGAGATCGCCACTTCTTTCTGAAGGCTCAACAACGACCATCGAAGATCTTATTAACGCGATTCGCGCGCAGAACAGTCGTTCCAAGAAAACTATTCCATCATCCGAAGATCCTCGCAACTCGACTACCCCTCTGTCCAAACAGAGAGACATCAATAAACCGGAGAGTCCGCTGAGAAAACCATCGTCTGATAGCATAATTTTGTCAACGAGAGCAACACCTTCCATCGCTTGCCGAAAGTCAAGCACCTTAACGCCAGTGACGTCGGTCAATCTGATTTTTGACGATCCAGACGAATTCACAATTACAACTCCCGCTACGAGGAACAATATGTCAAGCGAAGACTCTTTAAAGGTTTATTCTTCCGGGCAGATCTCACGAAGCCCTCCGGGTTCTCCCGGAAGCAGTCCGAAGGCTAGACGAAGATTACCTTCGGTACCTGCAGGCGACGGCGCACGTACGATTCGATGTAACAGCGACGGGAGCCGTAGCGAGAGCGGTTCAACCACGGCTTCTAAACCACTGCTGGGTCTCCCAGCGGAGCCCAGAAGCCGTAGGATGCTCCCCACTCCCCCACCGTCCCCCGTCGCTCCGCATAAAGAGTTCTCAAACAGTCGAAAGGCAAGCCATTCATTCACAAGTGAAAATTCCGCCGATAGTGACAATCCAAAACCAAACAGGAACAGTTGGAGTGGTTCGACGGACAGTGACACGATGGATGAAAAATCGCCCGCACCTTCTCCCTCGAGAAAGGAGTCTGGATTGTCATTGAGCCAAATTTTTAGCGCGTTTGCCTTTAAAACCCATTCAGATGGGACGGATGGAGCAGAAAAGAGCAAAGAGGCTGGAGAAAGGAATGAGTCTTACAAAATCCCTTCATCACCACAACGCCCTTCGCGTAAGAGTGAATCTCAACGTGACGATATCTTAGAGCAGCAGCGGCACTCAATGCTGTTACATTCGTACGCCTCTGGCAGCTTGCAGCCTCCTAGCGGGCCTAAACGACTTACAACTCGCTCTTCACAACCGAATTTGAAACTTTTAATGCCAGTTCAAGAAGAACCAATCAAATCCAAGCTCTCTCCGGCGTCCGTGCCATCCGGTTACTATGACAACTCAAAATTTTCTCCAAAACTCACCAGTAGACGGGCGAGCCTCCAATCCATAACTGACAAGAGTTTAACCAATCACGTCGCGTCGCAGGACTTGAGTGACGGCGACCGACTTCGAAGTGAGGCAGAAACTGGGTTCTTGATATTCCCTGATGATTATACTGGGCATAACTTGCTGTCTTCGCATGCAGTTTCTGGTATGGTGTCATTGCACATCACCAAAGTCACGAACTTGCCGTTTGCAGACAAGAAGCTCTTAGAAAAGAAAAAGAAGGTCTACTGTGCAGTTGAGGTGGATTTCGAGCGAAAAGCTTTCACAAGTAACAAACGCGCATCGAAAACTTTGACTTGGGATGAACTTTTTGAAGTGGAAATCCAACATGGTCGAGAAATCTGTCTATCATGCTTCACCTCTAGCCACGAGTTTGACAAACCCGTGGCGAAAGTCTCGTTCAATCTTTCACCATTTGTTCGATGCGGTCAGCAACACAACGTCGTGTTTCGAATGCAGCCTCAAGGAGCCATTCACCTCAAAATGGAATTCATTGAGATGAAGACGTTACTGAAACGAGCACCGTCCGATAGAAAGTCAGGCGTGTTCGGCTTTCAACTCAATGTGACTTCGCGAAACGAGAACGCGAGTGTTCCGTTGATCGTGCGCAAGTGCGTGGAGGAGATTGAGAAGCGAGGATTAATGCGCGTGGGGCTGTACAGAATCTCCGGAAACGCCCGACGAAAGAAACAGCTGCACGCGCTGTTTGACGAAGATAGCACGAGCGTTGATCTGTCGGAAGATAGTTACCCGGATATAAACGTCATCACAGGCATTCTGAAAGATTACCTGCGTGAACTCCCTGAGCCTTTGATAACGGAAGCGTTGTCAAAGATGCTGATCAAAGCCGCTAAAGATCAGGTTCAAGATCAAGATATTGCCTCGCAGAAACGTTTTCTTTCTAAGCTTCTCATTCAACTGCCGCAGGACAACAGAGAAACCCTCGTGTATCTTTTGAATCATTTCGTGCGCGTCATCAACGAGAAGGACACCAACAAAATGGACGCGCACAATCTGTCAGTGTGTTTTGGGCCGGTGCTGTTATGTCCCCCTGCGAACCTCACTGAGAGCAAGGACTTACTGGATCTCAAACTTCATATTAAAATTGTCGAGTTTCTGTTTTATCTTTGGAAGAGCACTGGTGTAACTACTGGATAG

Transcript

OS493_022231-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5VT97	Rho GTPase-activating protein SYDE2 OS=Homo sapiens OX=9606 GN=SYDE2 PE=1 SV=2
Q9V9S7	Rho GTPase-activating protein 100F OS=Drosophila melanogaster OX=7227 GN=RhoGAP100F PE=1 SV=2
A6QNS3	Active breakpoint cluster region-related protein OS=Bos taurus OX=9913 GN=ABR PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007735 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR052118 all species →	Family	Rho GTPase-activating regulator	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46150 all species →	RHO GTPASE-ACTIVATING PROTEIN 100F	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0016477 all species →	Biological Process	cell migration	Interproscan
GO:0046578 all species →	Biological Process	regulation of Ras protein signal transduction	Interproscan
GO:0097060 all species →	Cellular Component	synaptic membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_022231-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022231-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

16.2Max TPM

5.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.71	13.14
polyp at pH7 6	18	18	5.30	8.19
coral polyp · control treatment	16	16	6.05	15.49
coral polyp · oil and dispersant treatment	16	16	5.94	16.21
coral polyp · oil treatment	16	16	7.03	13.64
coral polyp · dispersant treatment	16	16	2.15	7.28
Polyp	10	10	3.69	9.68

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.14
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.75
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.72
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.82
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.51
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.96
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.26
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.17
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.16
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.14
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.88
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.81
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.20
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.24
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.49
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.42
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.19
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.22
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.83
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.71
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.01
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.38
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.33
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.99
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.89
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.88
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.67
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.84
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.79
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.73
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.49
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.72
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.76
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.71
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.34
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.55
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.14
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.98
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.81
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.76
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.18
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.96
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.92
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.13
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.13
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.21
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.82
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.20
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.03
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.81
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.02
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.95
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.08
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.91
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.78
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.50
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.00
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.63
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.57
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.60
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.64
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.93
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.99
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.57
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.76
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.17
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.97
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.11
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.26
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.79
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.58
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.66
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.30
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.76
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.53
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.31
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.05
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.30
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.23
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.95
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.75
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.58
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.47
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.68
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.83
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.34
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.75
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.04
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.31
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.72
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.45

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.