Gene detail

Detailed information of OS493_022262-T1 in Lophelia pertusa

Genomic Location: scaffold_90:1139362...1156504
NR annotation: KAJ7330647.1, Zinc finger protein dzip1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022262-T1

ATGAGCGAGGGTATGAACTTTTCGTTTGGAAGACGACAAGAAAAGATTGACTGGCGGCGGCTTGCATCTGTGGATGTTGACAGGATCCTGAGAGAGATGGATGTGAAGACACTGCAAGATAACATTATGCACGTCACATTTAGCAACATAGAGGCTGAGCTGGGTATGCAGGGCGTTGGTTTTGATCCAAACTATATCAAGTTGTTTCGACTGGCACAACTCATAATTGAGTACCTTTTGCATTCTCAGCAGTTCCTGTCAGCAAATCTTGAGGTGGAGAACAAGACACTACAGGAATCTCTGGACGCTGCGGAAAAAGCCAAGAAAGAACTAGATGACAAAAAGGAAGCCTACAGAAGACTTAAGAAAGAATGCCAGAAACAAAAGCAGTGGATTGCCGAGTATCAACTGTTGATGAGGGCTGGGGCGAGTGGATCACACAAGTGTCCATATTGTGCCAAGTCATTTGTGAGCCATGAGTACGTCATAGCCCATCTAACAAGACGGCACGGCGAACACTCCAGCCAAGTGAATGGAATGGTGATCTCGGCGGCACCTGTTAAATCTGTGGGTGCTGTAACCATGGAAACTAAACCTGGCATGACCGAGAAAGAGAAGAATGATCTTGAAGAAGAGTTGCGACTGATTAAAATAAGGGTGCAAAAAACAGAGCGAGAACTGCAAGAGGAGAAGAACTTAACACAATCACAGAGAGGCCAGTTGACAACAGAGGGTCACAAGATTGAAGAACTTAAAGCAGTGTTTGAACAGTGGAAGGAGGAAGAAACAGCCAAACAGCAGCAAGAATTAGCTGATTTCAAGAGAACGTACGCACAAGACATGAATAAAAGAGAAGCAGAAAAGAATAAATCTGATCAGGAGGTGACTACATTAAAAAGGCAGATGCGAGAAAGGACATCAATGATAGGATCAATAAGAGATGAAGATGAAACTGATTCTCCTTCCAAGGCGAACAGAGGTGAAATGTCACAACAGATTATGGCACAGTTGGAGGATAAGGTTATTCAGATACAGACAGAAACACAGCAGAATTTGCAGAAGGAGATGCAGAAAATGCAGCAGAAATTTAAAACTCGGGAAGATAAAGCGAAAAAAGAACACAGAGAAGAGATGGGACAGTTTCAGGAGATGTTGAGCCAGTATGAAGAAAACCTACAGAATGAACAAATAGAGAAGAATAGGATTTCTGAGGACTACGAGGGCAGAATACAGATGCTAACCTCGCAAGTTCAAGACCTCAGCAATGCACTAGACTCACGAAAGGTGGAAACAGAGAGAGTTCAGTACTCTTTTAATACTCAACCGCCTCCACTTCTTGCTTCTACGCCCCCGGTGCCTGCTCCAAGACAAACTGAGCGTCTTGTGCAAGCTGAGCCAAATCAAAGAGAGAGAGCAAAATCTCCTGACAAGAGTGTAACAACAGGAGACGTCATGACCCTTTATGTATCAACCAACCAAACCAAGTCTGGTCAGTATCGTCTATGGCGTCAAACATCCGATGGCTCCAACGAATGGTCCAACCTGTTCGCCTTCTCCGCCTTTTTAAAACCCACGGGGAACTTCACCTACCCGGTGTACGTGTTCGCCGCAGGGGGATCCCCGTACTGGCGGCAATATATATCAGGGAATTCATCCCCTCCCAGCACAGAGTATCGCCTGGACTACATGTTCTACTGCTCACAGACATCCTTGCCAGGGACTCTGTCGTATCACGTGCTAGAAGCAGGGAGCATACCTGTGATAAGGTCGTACGTGTCGAGGACTAAGAGTGTTCCCGGATGGAAGCATAAGGGATTGTCGTTCTATGCTCCTAAAACGGCTCTGAGCGGCGATAAAACATTGACAAGTATTTCTGCATCGTTTGAATCGACTTTGACAGAAGACAAAGAGCAAGACTTTGAACCAAGCGAATCTGAATCTGAAGAAGAGGTTCCCGCTCCTGTAGTACCAAAAGTTGAAGTGGAAGATGTTGATGCAAATGAAAGTACAGGAAGTGTTGAAGATGTCAAGGAGTTAACGTCAGGTCTTACCAGCTCTGAGTGGGGTACAGCCACTCTTGAATCCGGCGAGTTTCATCCGATTCCCCACAATCAGCTCATAACTACTCGGTTTAACCACAGATTTGATGAAGTGCAGGCCTGTAGACAGGAAATTGTTCAGATACTCGATCAGAAACTTTCCAAACAAGGATTATCGCCGGAAAATGCAAGACTTTCTTCGCAGAAAATTGAGGCTAAAATGGCTGCGCTGAAAACAGAGAGACAAGCACGAAGCAAGAAAATCAAGAATTTTACCGCAGTTAGACAAGAGTGTGTGGAGGAGTTGGAAGACATAGTAAAGAAGACTTATCGCAGTGGGACCACGCCAGGAAAACCTAGCTCACCAGTTCCCTCGGGTCCTCGTCCCGGCGCCCGTTCTCCCGCGGGTAAACCTCCGACGTTCAAGTCCACAGCAACCGCTGTCCGTACTTCCGCTTCACTGCAGCCAGGCCGGAAGTCACCTGCTCCGAGAGGGACCCTGGGTTCTACTGGCTCAACCAGCGGTGGTGACATGACGGTTAGCGTTACTTCCGTCACGGACCGTTCCTTCAGTGGTACCTCCGTGACTGAGCGGACTCTGAGTGAGTCTGAGGAGGAAGTTAGCGTGACTGAAGGATCACAGGAGGAGGAAGAGGAAGGGTCCACTGGGATTCAGAAGAAGAAGCTGCCAAGCCGACTCATAAAGTAG

Transcript

OS493_022262-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q32PN7	Cilium assembly protein DZIP1L OS=Danio rerio OX=7955 GN=dzip1l PE=2 SV=1
Q7T019	Cilium assembly protein DZIP1 OS=Danio rerio OX=7955 GN=dzip1 PE=2 SV=2
Q8IYY4	Cilium assembly protein DZIP1L OS=Homo sapiens OX=9606 GN=DZIP1L PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003624 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13815 all species →	Dzip-like_N	Iguana/Dzip1-like DAZ-interacting protein N-terminal	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR032714 all species →	Domain	Cilium assembly protein DZIP1, N-terminal	Interproscan
IPR051241 all species →	Family	DZIP and RILPL	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21502 all species →	ZINC FINGER PROTEIN DZIP1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0036064 all species →	Cellular Component	ciliary basal body	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_022262-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022262-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

35.4Max TPM

14.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.71	27.85
polyp at pH7 6	18	18	15.59	25.13
coral polyp · control treatment	16	16	17.61	35.39
coral polyp · oil and dispersant treatment	16	16	11.00	20.75
coral polyp · oil treatment	16	16	15.71	24.73
coral polyp · dispersant treatment	16	16	12.95	26.83
Polyp	10	10	9.92	24.98

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.85
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.75
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.79
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.69
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.31
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.77
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.61
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.89
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.72
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.35
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.59
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.21
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.25
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.05
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.66
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.74
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.13
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.65
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.46
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.79
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.12
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.65
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.61
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.58
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.20
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.59
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.56
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.90
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.24
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.02
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.36
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.11
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.02
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.65
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.70
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.16
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.64
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.55
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.36
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.61
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.92
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.75
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.45
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.43
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.15
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.43
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.75
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.47
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.20
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.55
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.32
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.07
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.65
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.99
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.83
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.11
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.96
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.58
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.01
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.91
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.73
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.91
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.84
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.95
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.38
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.72
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.14
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.72
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.78
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.36
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.38
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.35
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.10
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.66
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.33
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.83
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.05
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.42
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.23
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.64
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.63
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.21
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.52
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.48
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.77
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.25
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.01
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.37
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	24.98
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	17.73
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.42
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.41
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.64
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.86
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.68
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.34
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.