Gene detail

Detailed information of OS493_022279-T1 in Lophelia pertusa

Genomic Location: scaffold_90:1271949...1284862
NR annotation: KAJ7330664.1, ATP-dependent RNA helicase ddx3x [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022279-T1

ATGAGTCATGTGTCCCCAGCAAACTTTCAAGCTCTAGACCAGCGGTTCGCTGGTTTGGACTTGAATTCGGGCGCCGTTAACCCACACGGTGTCGATCCAAAGTCTCAACAAGAAAGATACGTGCCGCCTCACCTTCGTAACAGACCCGGTCCTCCTCCTCCTGGTCAAGGGGGCCCGTACCAAGATCAAGTACAGTACAACCCTGGACCACGCGACTTCGTCCCCAGGGATCCCTACAGAGATAATTTTTATCAACAACAACAACCACAACAAAACTTCTATGGAGGGTATCAGCGTGGTGGTGGTGGTGGGGGGCGTCCGTTTGGTAACCCCGGTATGTACAATGGTGGCCGCGGCGGAGGAAACAGTTGGCGAGATCGAGATCGAGGAGGTGATAACAGAGCGCCTTACAGAGGAACTACTACTGACTATGGACGAACCACTCAGCCACCACCTGAGGATTGGTCTAAACTGTTGCCAAGGAACGACCGCGTTGAAAGGGAACTTTTCAGCAGTCATAACACTGGAATAAACTTTGACAAGTATGAGGACATTCCTGTTGAAGCCACTGGACAAGATGTTCCCAAAAACATTGAGTTGTTTTCTGACAGTGATCTTGGTGAAATTTTACACCACAACATTGAGTTGGCCAATTACAAAAAACCTACTCCAGTTCAGAAGCATGCTATAACCATTGTGAAGAGCAAGAGGGACTTGATGGCCTGTGCCCAGACTGGTTCTGGGAAGACTGCAGCTTTCTTGATTCCTATTCTTAGCAGGATCTTTGAAGAAGGTCCTCCGCCACTCCCTGATGCCCGGCAACAGTCTCGCCGAAAGCAGTTCCCAGTCAGCCTTGTTCTGGCGCCCACCAGAGAGCTGGCCTGTCAAATCTTTGATGAATCCAGAAAGTTTGCATACAGGTCATGCGTGCGACCTTGTGTGGTGTATGGTGGAGCTGAAATTGGTGGCCAGCTGAAGGAGCTGGATCGTGGCTGTCATCTGCTGGTGGCCACACCTGGCCGTCTGGTGGATATGTTGGATAGGGGACGAGTGGGGCTGGACTCTTGCAAGTTCCTTATTCTTGATGAGGCCGACCGCATGTTGGACATGGGATTTGAGCCACAGATACGCCGCATCGTTGACCAAGACACTATGCCTAAAGCTGGAGAACGTCAGACGCTCATGTTCAGCGCTACATTCCCTAAAGAAATCCAGATGCTTGCTAGAGACTTCCTGGTGAACTACATCTTCTTGGCTGTGGGTCGCGTGGGTTCCACCAGTGAGAACATCACACAGAAAACTGTGTGGGTGGATGAGTATGACAAGAGGTCATTCCTGCTGGATCTGCTGAATGCTTCAGGTCCTGAATCTCTGACGCTGGTCTTTGTGGAAACCAAGAAAGGCGCTGATGCGTTGGAGACTTACTTGTACAATGAAGGCTATCGTACAACCTCTATTCATGGGGATCGCTCTCAGCGTGAGAGAGAGACAGCACTGGCATCTTTCAAGTCTGGCCGCACACCAATTTTAGTGGCCACTGCTGTGGCTGCTCGTGGCTTGGACATCCCTAATGTGCGCCACGTGGTAAACTTTGACTTGCCAACTGATATTGAGGAGTATGTTCATCGCATTGGTCGTACCGGGCGTGTTGGACATACTGGTCTTGCCACATCATTCTTCAATGACAAGAATCGTAATGTAGCTAAGGACATGGTTGAGCTGTTGAATGACACCAAGCAGGAAGTGCCAGGTTGGCTGGAATCCATTGCATACGAGAGCCACCAGAGCTCAGGAAGGAACCGTGGAAGGAGCAGGCAATCAGCTGGTGGCTTTGGGTCACGTGACTACAGGCAGCAACCACATCACCGTGGGGGTGGGGGTGGAGGGTATGGAGGGTATGGTGGTGGTGGTGGTGGTGGTGGAGCTGGTTACTTTAATCCAGCCCGCTACCCTGGCTCTGCTAGTACCCAGGATTGGTGGAACTAG

Transcript

OS493_022279-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O00571	ATP-dependent RNA helicase DDX3X OS=Homo sapiens OX=9606 GN=DDX3X PE=1 SV=3
O15523	ATP-dependent RNA helicase DDX3Y OS=Homo sapiens OX=9606 GN=DDX3Y PE=1 SV=2
Q6GVM6	ATP-dependent RNA helicase DDX3Y OS=Pan troglodytes OX=9598 GN=DDX3Y PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000960 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000629 all species →	Conserved_site	ATP-dependent RNA helicase DEAD-box, conserved site	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan
IPR014014 all species →	Domain	RNA helicase, DEAD-box type, Q motif	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47958 all species →	ATP-DEPENDENT RNA HELICASE DBP3	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003724 all species →	Molecular Function	RNA helicase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0007276 all species →	Biological Process	gamete generation	Interproscan
GO:0030154 all species →	Biological Process	cell differentiation	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11594	DDX3X, bel; ATP-dependent RNA helicase DDX3X	EC:5.6.2.7	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022279-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

176.4Max TPM

55.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	30.19	42.48
polyp at pH7 6	18	18	36.13	49.04
coral polyp · control treatment	16	16	75.75	160.95
coral polyp · oil and dispersant treatment	16	16	98.88	155.28
coral polyp · oil treatment	16	16	49.97	100.69
coral polyp · dispersant treatment	16	16	72.42	176.44
Polyp	10	10	17.71	33.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.48
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.74
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.59
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.17
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.15
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.58
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.43
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.09
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.07
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.82
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.56
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.54
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.71
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.38
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.38
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.20
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.65
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.95
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.20
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.95
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.24
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.16
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.20
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.18
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.82
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.87
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.13
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.64
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.75
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.64
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.30
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.33
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.95
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	160.95
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	148.19
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	110.65
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	105.13
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.72
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	77.56
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.57
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.36
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.75
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.44
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.02
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.06
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.37
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.91
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	155.28
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	134.25
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	131.54
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	129.07
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	127.88
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	123.89
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	113.31
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	100.36
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	98.42
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	98.07
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	90.54
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	69.80
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.32
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.08
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.59
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.69
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	72.16
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.16
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.08
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	63.49
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.62
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.11
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.53
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.41
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.72
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.64
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.57
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.48
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.00
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.91
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.87
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	176.44
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	127.29
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	113.39
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	100.70
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.45
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	72.80
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.76
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.58
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.56
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.98
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.72
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.05
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.32
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	33.37
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	28.56
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	25.21
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	19.96
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	15.36
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	15.35
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.96
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.02
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.82

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.