Gene detail

Detailed information of OS493_022336-T1 in Lophelia pertusa

Genomic Location: scaffold_91:521177...546247
NR annotation: KAJ7390778.1, Ubiquitin carboxyl-terminal hydrolase 34 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022336-T1

ATGTCTGGTTGTTTAGAAGTCAGTGGAAATGCGCTATGGACACAATGGCGGCAAGAATGTCTTGCGCACCTGTTGAAACTAATCTGTGAGTTTGGGACGATGAAACGTAGCAGTGATGATGATGATGATGTTTTCGCATCGTCTGCTGAAAGTGACGTGAATAAGTTGCAGATTCAGAAGAAAGATGGACAGTTTCGTGTCAGGTACAAGAGTACTGATAAAGAGGAAGTGATTTGCATCAAGTGTTTGTCGTCCAACCTTATGTCCATTGTTAATGTGAACTTGCTGTTGGAAAAATTACTTCACATCTCTTATCAGGCAACTTTGCCAATTCATGGAGGCCAGAGTAGAGTCAGTGGGGGAGAAGTTGTTCATCATGCTGTGTCGTTGCTGGTGTCAGCTGCCTTCACTGACGGCACTGTTAGAAGCTCTCTTCTTCGACAAAGTAACTTTAAACCTTGGCTTCAGCAGCTGGTGCTTTTAGCTAAAGAGCCTAGTGTACGATTTGAAGCCTGTCGTGGACTGTATCGACTGAGCCTAATCAAAGAGAACTCCTGCCTCATACAGCTGATGGACGCTCTGTTAGACTCTCTTCCTTTAGCGCAATCTCTTCAATCGCGAGAAAACTCTCACGGGAGGCGGCAAGAGCCCAGTGCACGGGAATACTTTGCTATTCTGTGCAGACTTGTGGATGGCTTGCCTACAGTGGAGGGAGGTCAAAAGGATCATGACGTTGACCTGGATTCTCTGGCTAAACTGCTCGCCAAATACATACGAGACTGCCAACCACACACAAGGCAGAAGTATGGTAGTTATGAAAACGAAGGTCTGAGTGGCATGTTAAAACTGTGCACAGCTGTTATGAGGCATGATCCATCCTTTAAAATGTCCTCTGATGGGCTGGAGTTTCTGAGAGATGTATTCCACTCCTGCTTGTTTGCTTTACCAGAGGATTGCTGTGATGAGAGAGATTTGCCACTCTGCAAATCTAAGCTGGCCAGAAGTGCTGCCTTTGATCTCCTTCTAGAGATGGCACGAGGCTGCCAAGAAAACTTTCTTGAAGTTCAGAAACTGTTGTTGAAGCATCACAGTTCTGATGGTAGAAAACGTTCTTCTTATGGCTGGCACTACTGGCCTCATGACAATGGTCGTTCACCATGTGGGCTGGTAGGAATGATCAATTTAGGAGCCACGTGCTACATGGCCTCCTGCATGCAACAGCTCTACATGATGCCGCAAGCCAGGGCCGCTATTCTCAACTCAAGGATCACGGTGATGTTAAACATGAGGCAAGTGAAAGAAAGGCTTACAACCCTAAAACCTTCTGCCGAACATACACAATGGACAAACAAACCGCTGAACACTGGAGAACAAAAGGACATGACAGAGTTCTTTACTGATCTGATCGGCAAAATAGAGGAAATGTCTCCGGCTCTGAAAGTGTTGGTGAGAGATTTATTCTGTGGAGAGATAAGCAACAATGTTGTGTCACTGGACTGTTCACACGTCAGTAAGACAAGAGAAGAATTCTATTCTGTTCGGTGCACTGTGGCAGACATGAAAAGCCTCTATGAATCGCTTGATGAAGTGACTATCAAAGATACGCTGGATGGAGATAACATGTACACATGCTCTCAGTGTGGAAAGAAAGTTAGAGCTGAGAAAAGGGCCTGTTTCCAAGTTCTTCCTCGCATCCTTTGTTTCAACACCATGCGCTATGCATTCAACATGGTGACCATGATGAAAGAGAAAGTGAACACACACTTCTCTTTTCCACTTCAACTCAACATGGCACCATATACTGAGGACTTCCTGATGGGGGACAAACAAGACCAAGACCCTCAGCTCGATCCAAGTTACTGGTATCAGTTGATTGGAGTCGTAGTTCACACTGTGAAGCCGTTTGATCCTGCGCAGATCGCGTCGGAATGTTTTGGCGGCGAAATGACAACCAAGACCTACGATGCAGTCACAGAGAAGTTCATGGACTTTTCATTTGAGAAGACACACAGCGCCTACATGCTTTTCTACGAGCGATGTGATCCAAATGAGAAAGACCTGTTGGCCGAAACGCCAAACATCGAGTTAAACCAGGAGCTGGCTGACTGGATAGGACATGATAACATCCAATTCTTGCACGACAAACACGTGTTTGATACAACTTATTTCAATTTCATGTGGCTTATATGCAGTAATATTCCACCTTCAGTTCCAGAGTCCAGAGAGGTTGTACTGTCCAATGTCCAACTGGGAACGTCATTCTTGTTGGAAACCCTGGTCCACGCTAAAGAGAAGCTGCTGATAAAGAACTGGGCAGACTTGCTGCTGACGCAGTATGAGCAGTCATTCATGGTGTGTCAGTGGTTTCTGCAGACACTGGCAAGCGAGGAGTGGTTACTTCAGGTGTTGGTCAAGTGTCCCATACAAAGTATCCGGCATATGTTTGTTCGACTCTGCCTGGATGTTATTCAGATTCTGAGGCCTCTTTATGCGACCCACGCAGACGAGGAAGCAGATGTTGAAGCAGAGAGAACATACTTTGTTTGTATCAGCGGGTTTGTCAAAGCTGTCTTCAGACTCTTGGAGCAGAATATCAAGGCTTATGTGAAGAATCTTTCGGAAGTGTTCTGGTTTATTCACCAGTTTGCTGTACTGGGCAGTCAAGAGCGTGAATTTCTTCTGAAAATGGACGCCATATCAGTGATGGCGGGATTCTATCTTGGAACAAAAGCATCTGAACTGAATGAGTCAACAACAGAAGAAGATGATGATGGCGATGATGATGATGATGAAGAGGTGGTCACCATTCTCCCAGAAGATAAATACCGCGTGGGGTCCCTGGAGAAGATGATCTCTGTCATGGCGCTGTTAGTCGAGGAATCGCGAGGCGAAAGGCAATTACATCTGTCAGAGAACGATTTGGCTGCGTTAACAGGAGGAAAGGGATTTCCATTCCTGTTCCAAGTCATCAAAGACAGCATCAACCTGCGTCACACAACAAACCTGATCTTCGGCCTGTGCAGATACAACCTCAAGCTTGCAGAAAGCATAATTTCTCTGTTGATGTCATCAGTACAGAAACTGCCACCAGAGCAGTCTCATTCGTTCTTCAAGCTGTTGTCAATGTTGACAGAGATGCAGGGGGGACCACCTGGTATGCCATCCTTCACTAACCTCACACTTCAACGCATCTGGGAGGCTGCTGAGTATAATGCTGCTCTTTGTATAGACTGGCTGACCTGCATGGCGCCTAAAAACAGAATGGCGCATCAGTGGGTGCTGGATAACATGGATAAATGGGTGGAGAAGTACCTTATTGCAGACAACAGTCTGAGAATTAGAAACGCGTCTGCGTACCTGCTTGTAAGCCTGGTACCTAACAACCACTTCAGACAAGGATTCAGGTCAAGAAGCTTTTCTGCTCCTCACAAGGAAATGGTGTTGAGTAAAGATGCTCTCTCCATTCTCCACGAGATTTTTAAGATGTTGCTTAACTTGCTTCCAAGAGCTCGAAAATACTGTGACCGCAACATTCATGGCACAACAAAACTTGTCAGCTATTTCGCTGTGTTGAACTACTGCCTGGTATCACGAACCGAGAAGGAAATATTCACAGCGTCTTGTACAGAATTATGGCGACTGTTTCATCCGCTTATGTCAGAACCAAACATTGCTGTACATCCTAACAAACAGGCTTTGTTAATCTTCTGGTTTCACGCTTGTGTTGACTGCGAGGAGAACATCGACTTTATCACGGAAAATGGCAATGTGGCTGCAAACATACCGCTTAACTACATTCTCTCCAGCGATGAACCGGAAGTGGTGACGTTTAACAGGAATGTACTTCCGGCGTACTATGGTCTGCTGCGGTTGTGTTGTGAGCACTCTCGTACATTTACTCGCCAACTCGCCATTCATTCCAACATGAAGTGGGCGTTTGAGAATCTCACGATTCGTATGAATCAATACCCACAGGCAGTTGAGGAGCTGTTCAGTCTCATGAGACTCTTTGCTGGTCTGACAACCCCTGACTCGTCAAAAGAGAAGACTAAAGAAGAAGAAGCTGTCGAGGCAACGTTCAGACGAGACACCATCATCCTCTACCAGAGCTGTTTGGACGGAGGAGCATCGTGGACAACGCTTATCAGTGCGTACAAGATCTTACTTCAGACCGAAGAGGACAGATTGACAGTGGTCGTCAACCAAGGACTTCTTACTTTGGCAGATGCATTCACGACTCTTCACATGATCAACAAACCAGATGTTCGTAGCAGCATTGTAGGATGGTCTGAGAGATTTGATGTCGCTCAAAAACTTCTCTCGCTGTTAAATTCTTACACGCCGAAAGAAGTGAGGCAATCTTGCCTGGATGTGTTAAATGCCATGTTTAGTCTGTACCCTAATGACATCACTGAAGCACTGATTCCTATCATCAATGCTTCTCATCAGCACTGGAACAAGACGTCCCCTCCAGGACTGCTTGGTCCGTACTTTCCTCGCCGACACACCAAAGTGATTGTGAGCAGCAAGTCTGTAGCGCGGCCCGCTGTACCTGAGCTCAACATGTTCCTCCATCCTTCATTCCTCGACTCGCCGAAGGGTGTGGAGGAGTCTCATGACAGGGTAGTGGATCATGTCATCGTCTGCAGTTGTCTTTTGGCAGTAGAAGCCATTCCTCTTCACTTCACGTTCTTCAGCAAGCTGTGGATGGAAGTGTATCAGAAGGGTGGTGATAATGCCAAATACAAGAGTTATATTCAGCAGCTCTGTCAACAGCCCGAGTTCCTGGAGTACGTGGATCTGATCTTACTGGATGAACGAGAAAGTCTCAATGTACGGGATATCTACACCTTTCTTTGCTGTTTCTTTCCGAGGACACTTGTAGCGACAGTAATCGCTGATAAACCTGTAGCGGAGAAAGCTTGCGATGCTGAACTGTGTGCAATAGCCAAGAGGCTAACTGCGGAACTGCGAGCGATGTCTCTACTGTTCTCTGTGAGGCCGCCACTGAAATCTGATGTAAGCGCGCTGCTACAGCCGAGTCTTGGCGAGCTGCTGGTAGTCTGCCGCAAGTATCAGGCCAAGAAACAGGAGATCAAGTCACGACCGCCTAGCGAATCTGAACAACAGCAGCCTTCCACGCAGCAGCAGGATAAGGAGGGGTCCTCGGAGGAGCGAAAACAGACGGAGAAGAGGAGCCGGTGA

Transcript

OS493_022336-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q70CQ2	Ubiquitin carboxyl-terminal hydrolase 34 OS=Homo sapiens OX=9606 GN=USP34 PE=1 SV=2
Q6ZQ93	Ubiquitin carboxyl-terminal hydrolase 34 OS=Mus musculus OX=10090 GN=Usp34 PE=1 SV=3
Q9VC56	Ubiquitin carboxyl-terminal hydrolase puf OS=Drosophila melanogaster OX=7227 GN=puf PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002255 (this species only)
Ubiquitin family	DUB\|USP\|USP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12030 all species →	DUF3517	Domain of unknown function (DUF3517)	Family	Interproscan
PF00443 all species →	UCH	Ubiquitin carboxyl-terminal hydrolase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR021905 all species →	Domain	Ubiquitin C-terminal hydrolase-like, DUF3517	Interproscan
IPR028889 all species →	Domain	Ubiquitin specific protease domain	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR001394 all species →	Domain	Peptidase C19, ubiquitin carboxyl-terminal hydrolase	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR018200 all species →	Conserved_site	Ubiquitin specific protease, conserved site	Interproscan
IPR050164 all species →	Family	Ubiquitin carboxyl-terminal hydrolases	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24006 all species →	UBIQUITIN CARBOXYL-TERMINAL HYDROLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0016579 all species →	Biological Process	protein deubiquitination	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24169	THADA, ARMC13; thyroid adenoma-associated protein	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022336-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

48.7Max TPM

19.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.20	24.97
polyp at pH7 6	18	18	18.77	30.47
coral polyp · control treatment	16	16	26.34	48.72
coral polyp · oil and dispersant treatment	16	16	21.70	47.06
coral polyp · oil treatment	16	16	21.30	30.02
coral polyp · dispersant treatment	16	16	14.88	27.74
Polyp	10	10	10.61	19.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.97
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.69
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.66
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.45
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.06
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.37
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.01
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.55
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.55
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.81
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.62
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.60
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.41
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.62
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.71
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.52
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.47
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.23
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.72
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.68
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.64
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.63
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.04
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.60
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.22
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.60
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.17
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.04
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.55
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.98
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.69
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.13
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.72
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.90
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.48
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.03
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.90
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.43
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.96
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.80
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.97
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.18
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.09
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.07
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.67
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.68
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.06
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.24
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.22
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.61
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.23
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.65
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.37
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.88
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.14
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.70
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.41
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.23
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.01
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.80
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.79
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.81
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.02
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.66
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.90
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.16
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.97
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.63
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.42
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.41
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.31
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.28
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.76
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.31
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.28
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.78
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.30
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.74
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.67
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.43
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.16
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.81
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.34
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.18
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.72
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.23
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.12
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.09
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.95
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.13
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.15
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.14
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.34
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	16.06
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.67
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.67
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.33
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.93
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.83

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.