Gene detail

Detailed information of OS493_022527-T1 in Lophelia pertusa

Genomic Location: scaffold_93:881877...897058
NR annotation: KAJ7378542.1, hypothetical protein OS493_022527 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022527-T1

ATGGCAGCACTGAAGAAAGGAGATGTAATCTTCCAACTTCAGCGGCGAGGGTACTTCATATGTGAACCCAGCCTTTACGAGCCACCAAGGATCATGCGATCTACATCTATTCTCTCCTTACAAATATCAATTACCAGACAGCAGACAGTTAAAGTAATAAAGACAAGTAAACTTTTAGGTGGTAGTAGAGTCTCTGTCAACGACCTGAAAGAATTTGCCGCTAAACAACAACAAGAAATTGTCGCCAAAGAAAGAGAGCTAAAAACAAGACAGATACAACTTATGGAGATGAAACGGAAATCACAAAACAAACCTCAGAACCGATACATAGATCAGCTATCAACTAAGGCTGATGAGCAGGAGAAACGACTGAAAGCATTGCGACAGGTCCAGGATCAGGTGGATACCTACAAACTCAGTAACAGCGCTTTGGCTGAAGAACTGGATAACGTGCGTTCCCTGTTCATGGAAAAAGAGAAAGAGCTGGCCATTGCAGTGGTTAAAGTAGAAAGCCTCACGCAACAACTGGATAAGCAAAGAAAGGGCTGGTCCCAGTCTTCTCCGAGTCGAGAGAAAACGCACCAAGAGCTGGAACTGGAGAGGCTTAGGAAGGAGTTGATGACGCGAAATGAACTCAACCATCAGCAGAGCGTTCAGATTCAATCACAGAAACAACTTCTCGCCGAAAAACACAAGGAACTCTTCGAACTTGACGCTCAAATTGACCACTACACGAACGATTTGCGACAAAAACGATCGCAGGATAATCACACCAAACAATCAAACCATCGTGTGAACGGTTCAGCTTCACCCACAGGTGAACAAGACTTTGTGGAAATGGATTACAGTAATCTTGGTAGCTTTTCTAAACGATCGAACAAAACTAGTAATGGGGATTCTAAAAACACAAACTCGACCGGAAATGCACCGGCAACTTCCGGTTCTTTTCGTGGGCGTGGTCGTAACGCAAGGAAGTTAGAAACGTTGCTCGAAGTAGAAGAGGAAATCTCTGATGGTCACGCAAGTAGTAAGTCCTCCACGGAAGATCTCACGCAAGGACCAGGTCCTCCAAGAGCGTCACGCGTGACGACGCTGAAGTCACGCTTTGAAACGGATGGTGTTACAGAAGGCGGGAAGCGTTGGAGCTCTCGCGATAGAGAATTAAGAGGCACGAAAGATATCACTTCGTCCACGAAATTGTCAAACGGTTCTTCTAATCCTTCGCAGCGTGTAGATCCCGAAGGAGTGGAAACACCCGTAATTCACGCGCGTGAATTATTTGACCTTAACGGAGTGCATTCAATGGACGAACAGAGAGCAAAACGTTACTATAGTATGAATGAGTTCATGGATATTTCATCCTTGAAAATAAAGCCTAGACAAGATGCTGTGGGAAATACCGAAGAACGAAATCCAACTTTGCAACAAGGCGAGTTTGAAGTCCCGCATTCGGCAGAAATCAAACATATTTTGAGTGGATTAGATTTCAAAACCGAAGCGCCATCATGTAGCACGGAGAGTTCCACTCCAAGTGATGGAGGGGATTTTTCGGGGCCGAGTTCTCCTTCGTCGTTTTCGTCTTCGTCGTCCGCCTCTTCGAACTCGATCACTCGGCCCAAAGCGGCAGTGTTTGCTATTACAGGCGTTGCTAAGAGAACCGACAACTTTTCACTCCCTTCAGATCCACCCCAACACCGAAACGCGGAAACAAGTAGCAAAGCTTCTCCTCAGCGGAGTTTTCAAGGACTAGCAAATACTGCGCAATATCAAGGACTTTCCAATGCCAACACGTTTCAGCCCTTAAACGCAGAACCAGAGGAACCAATTCCTGGTGTTTTATATAACGAGGCAGGCGCTAACGACCTCCCATTGCAAGCTCGGCTAGTCAAATCGGAAGCCTTTCCAACGAAGAACGAAAATGTTGATTCGATAGCGCGGGCAACGGTGATGGATTTTTCAAGAAGTGGGACGAAACCCAAAATGAGTGCGAAGCAAACTGACGGAACAAGCGGTAGTGATGGACAAAGAGCGCTTAGATTGACTGAAGTGAAAGCTTTGGAGACGAAACCTAACCGAATGAATGTGACGACAACTAGTGGTGACCATGGAGGAGAAGTCCCAAACCTGGCGGAACTCAAAACTGCAGAGTCTAAGGTTAAAACGGCGGGGAAAGCGCAATTGTCGCGGCTTTGTTATCAAACACCCGCCCCACTCAATAACAGAATATCGCCGCAACGACAAGCTATGCGTAACAGCGAATCACAGCTTCGCTTGCAAAGAAATGAAGAGGATTCTTCATCTTACAACAACGAGAAAGCTCGCTTAGAAGATACAAAGATGACGGTGGATGATTCTTCATTTGAAATGAACAAGAAAACTTCAATAAATTATTCTTTGCCATTGTTGCTGGAACAAAATTCAATAAAGGCGAATGGTTTTGTTCAGAAGGAAAAATCGGTGGGGTCCTCGCCCAGTTTCGGAAACTCAAACGAGGATTATAAATCCGAACACCCTAACGATGAAACCGATAACGTAAAGCGTTTGTCTGATATCGTACAGAGCTCTGAGAAAACAACTTACGATCGATCACAGATCGCGCCGTTAATTTTCAAACCGATATCTTTTCGTGCGAAAAAAATGCCTGGTGACCCAAACATGAACACATCTGCTAATCGATCACAACTCGCGCCATTGATTTCCAACTCGATATCCATTCGTGGCCAGACGTCACTTACGAAGATTACGGTAACTCCATCTGCTTCATTTTATTCGGCGAACAATGCGATGATTCCCGAGAAACGCTCGCCGGTTCCGACGAGCAAACGAACGAGGTTTATGTACCGAGGCGTCGCTCCGACTTATCCCGAAGTGAACGAATTGCTGGTAAATGACGAATCGAGTGATGACACTTTTCACGATGGCGAGGAACGAAAACACGAAGAGTCTGTCGATAAGGAAAGCGCAGAGAAGGAAACTGCGTTTACAATTCGAGAACAAGGGAGCAAACCAAGAAAACCACCACGCCAAGATGCGAAACAAGTTGTGTCATCCTTTAACATACAGCTATCGAGTCGAAATAAAAAGACGCTTCAAGAGCAGGAAGACACTTCTTCTTCGGAAGGAGATGATAAAACTATTGGATCAGTAGCAACGGGATCGAAAATCTTCGTCGGAAAAGAGCTCAATTCCGACAGTGGTCGGCTTGGTTCCGAAAGTGGTGGAGTACATTACGACAGCAGTCGACTAAGTTCCGAAAGTGGTCGGATTAATTACGACAGTAGTCGACCTAGTTCCGAAAGTGGTCGGCTTAGTTCCGAAAATGGTCGATTAAGCTCGGAAAGTGGTATTGACAAGTCACGTGAAAGTTCGCCGCTAGGTTCATATCCTGAAGCTCAAACATCCCACACTGTAAATAGTGAAAATGTTGCTGGGGGTTTTCTCTGGAAAAGTCAACTCGAACAAGCACCTTTGTCCAAAAATATATTAACCGCACCAAGTCTTTTTAAACCGCTACCATCTTCAAGGCAAGTTTCATCTCCTATACACACCGACAATGTACAGAAAACTCAAGAATCATTCCCTTCAAAAAACGCGGCTCAAAAATTGATGATTTTATCTAACGGTGAATCGCTACCTAGCGAATTATCTCCCTCAAGAACTAGCCCAAGTGGCAATATGGACGATGTAGTTTCAGAAAGAACGCCTCTAAGCGCGGATAAATTTCAGAGAAATGTGGAAATGAAAACGATTTTAACAATTAAAGACTTCCCTCTTAAGATTACGGATGTTGATGAAGCGAAGCCTGTGGTGGACAATCCTAGTAAACCAAACAGTGATGGAATCACAGCTCTTCACAATGCGCGTCTGCGCATGTCACGACCAAGTGGTTCATTTCCTCGTGGCAATACGGCGCGGATATCAACTCTCCAGACTCACACGGATGGACTCCACTCCATTGTGCTGCCGCCACAACGCCACAGAAATGGCTCGCTTTCTTGTTTGAACAAGGCGCGTGCGTTTTCGCTGGCGACATCGCTGGAGAAGAAAACCCCCTTACAGTGCTGTGAGCGTGGCTTGCCTGGCTACTTCAACTGTATGAGATATTTGAACGGTAGTCACTTCCACGACGTAACATTCGTTGATTGTGTAAACAGTAGAACGGTATGTGCAGCAGAATTTGGGCTCCTTAATGAAGGCCGTGTGTACGCGCTGTATAACTACTCAGCTGATGAACAAGACGAGTTGAGTTTTTCGTGTGCGGTGAGGAGTTTACTGGTGCTGAAACGGGAGATGCGACCGAGAAGGAATGGTGGTGGGCCCAGAACAAGGACGAGGAGACTGGGTACATACCAAGAAATTTACTCGGGGTAG

Transcript

OS493_022527-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13625	Apoptosis-stimulating of p53 protein 2 OS=Homo sapiens OX=9606 GN=TP53BP2 PE=1 SV=2
Q8CG79	Apoptosis-stimulating of p53 protein 2 OS=Mus musculus OX=10090 GN=Tp53bp2 PE=1 SV=3
Q5I1X5	RelA-associated inhibitor OS=Mus musculus OX=10090 GN=Ppp1r13l PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003766 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for OS493_022527-T1 in Lophelia pertusa.

InterPro

InterPro term	Type	Description	Source
IPR047163 all species →	Family	Apoptosis-stimulating of p53 protein 1/2	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24131 all species →	APOPTOSIS-STIMULATING OF P53 PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0002039 all species →	Molecular Function	p53 binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0042981 all species →	Biological Process	regulation of apoptotic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_022527-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022527-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

6.9Max TPM

2.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.34	3.23
polyp at pH7 6	18	18	2.20	3.39
coral polyp · control treatment	16	16	2.72	4.84
coral polyp · oil and dispersant treatment	16	16	2.21	4.11
coral polyp · oil treatment	16	16	2.54	4.30
coral polyp · dispersant treatment	16	16	2.04	6.94
Polyp	10	10	1.55	3.32

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.23
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.22
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.17
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.14
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.77
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.66
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.64
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.52
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.20
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.48
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.27
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.18
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.39
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.38
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.06
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.86
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.80
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.31
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.23
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.11
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.09
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.08
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.87
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.73
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.60
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.51
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.43
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.31
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.85
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.52
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.84
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.28
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.26
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.80
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.79
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.47
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.19
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.15
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.96
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.74
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.63
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.37
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.77
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.11
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.44
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.72
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.63
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.45
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.86
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.85
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.83
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.82
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.62
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.49
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.07
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.30
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.98
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.39
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.14
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.67
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.64
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.29
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.24
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.03
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.72
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.48
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.38
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.37
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.94
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.06
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.75
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.72
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.05
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.91
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.91
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.61
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.57
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.28
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.24
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.93
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.34
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.21
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.32
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.63
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.07
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.01
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.60
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.26
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.78
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.34

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.