Gene detail

Detailed information of OS493_022682-T1 in Lophelia pertusa

Genomic Location: scaffold_95:1310005...1348176
NR annotation: KAJ7357864.1, negative regulation of motor neuron migration [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022682-T1

ATGCGTGCGTCAGGAGTTCCTCGCGGCAGCCATTCACGCACTGATCCACGAGCGTCCACGAAGCAGCCAAACGAGTTGCCACGAGAGATCGGCGTCTTGTGTGAGAAATGCAACAACAGACTTGTGGAGTTAAAAAGACAGGTCATGAGGACGATTCTACCGGAAATACAAGGTGTTTTGCAGAAGGAAAGAAAGAACAAAACTACGGGATCTCTTTCTGCAAGAATCTTCGACCAGATCCGCCTTCCGGAAACACAAATGAAGTCATGGAAAAACGAGCAGTGTGAAGTGTGCTCTACAGACCTGAACCAGCTCAAACGAGAAGCCGTTGCCATGGTGCATACCTTGGAGGAATCACAATTCCTCGCTTACTACAACATTCCCGGATATGTGGTGGGACCGAACGCTGACCAGCTCATACGACGGGCGGACAAGCAGCGCCTGCAAGCCGGCGTCGCCATGGAAACGGGTGATCGTGGTGGAGGGATGTATGGAAAGCCGGAAGAGGCGGCCATTGGTTCGTCGTTTCTGTCAAGGGCCGCTCAAAAATTACTGTCCTCAAAGAAAAAACACAAGAAAGGACACAAACAAGACTCGTCTACAAACCACCCCTCCCCTACAGTCGAGTTAACATCGTCAAGGCATGCGCAGAAAGAAATTCAGCCTTACCCTTTCCCGACAAAGTTCAAGGAAGTTCTTCGAATATCAAGCCCAGCTGTGCCACCTGGCCTGCTGAAGATGAATACAAAGAGAACGGATGGAAAGGTGAAAGTGATGCTAAGAATTTGTCCGTCATTTCCGGGAGAGACTGGGTCCTTTATGAAGGTGGATCAGAAAAGAAAGCAAGTCACGCTGTACGATCCTAGCACCGTGGGTCACGTGTCACAGACGCACAGGAAAATGGGCGTGGCTGCACCTAAGATGTTTGCATTTGACTCGATATTTGAGTCCGATTGCTCTCAGGTTGAAGTTTGTTCAGGATCGCTTGTGGATGTTCTTCAATCTGTCGTTGGCGGATCTGAAGGGTGTCTGTTTTCATATGGCTATGCTGGTTTAGGTAAAACCAACACTATGGTCGGCCGAGACGAAAAAGAGCAAACCTTGGGACTAATCCCCTGTGCTTTGTCGTGGCTGTTCAAACTGATCAGCGAGCAGAAACAAAAAACGGGGACAAGATTTTCCGTTCGGGTGTCAGCGGTGGAGATCGTCGGCCGCTCGGAAACCGTTCGGGATTTACTCGCGGAGCAAGCTACAGGTTCAGAAAATGGCACGGGTGATCCAAGTCCGAGCGTTTTTCTCCGTGAAGACCGCAATGGCGGAGCTCAGGAGATCAATCCCACAGAGCTTCGCGTAGCAACAGCTGAAAAGGCAGCGTACTATCTGGACGCAGCTGTCGCCTCGAGAACAAGGCCACTTAACAACAAACCTGAAGGCGAAAACACAGACCGGGAGGAAAACATGAACTCTCACATGTTCTTCACTGTGCATATTTATCAGTACCGTGTGGAGAAAAACTCCAAAAATGCTGGAGGAGTCCACGGAGGTCGCTCCCGGTTACATTTGATCGATCTCGCCAGCTGTGAAGGGTACACTGGGTCCAAGAAAGATGGAGGAGCGAGCAGCATGTCACTGTCAGGGCTTGGAAACGTCATCATCTCTCTCATAAATGGCGCCAAACACGTGCCTCACAGAACGAGCAAGATAACGCGCATGCTCCAGGAGTCCCTTGGGAATGCGTCCTGCCGTACAACCATGATTGCGCATGTGTCACCCTCGCTTCCATTCTACGCTGAGACACTGGCGACCGCTCAACTAGCGACCAGGCTTCACCGGTTGCGAAAGCGCAAGGGAAAGGGGTCCAGTACGAGTTCTTCCGGCGGCGATAGCTCCTGTGACGAGGCCCGAATCCGAAAGCCAAGAATTCGGACAGCCGAGCCTAGGCTTCGGACCACAGCGTTAAACGAGAAGCTCCGCGAAGATTGCCCGATCGGTGAACCGGGCAGTTCCGACTACAACTCGAGCACAGGCGAAGAATCGTGCGACACCGTGATCTACGTGGGTCCCGACGGGGAAATTAGTGATCGGGATCTGACAGATAACGAGGGCCCCCAACGAGGCTCCCTATCAGGAAATCAAGCGTGTCCCAGCAGCACAAGGTCCCTGGTGCGGAAACTCGAATCGATTGAGAACGAGGAGGCGGAATACAACGAAGAGGGCGACGACTTGAAACGCGAAGTCGAGGGAAGCGAGGATAGCGGGAGCCTTGTTGAGGGAAAAGCACAAATATTTTCCGAACGAGAAGAAGGAGAGGGGAAGAATTCACTGAAGATTACACCGAGGAGTCGTGCTACGAGACTGAAGTTGAAATCCTACCAGACAACCGCGCAGCAAGTCGAAAAAGACTTCTTGATAGCAAGGAGTGCTGGTCGAGTGTTCCAGAAACCGCGCACAGGGACAAAGCCAAGCGAACTAAGACGTACCAAAGCGATATAG

Transcript

OS493_022682-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7TNC6	Kinesin-like protein KIF26B OS=Mus musculus OX=10090 GN=Kif26b PE=1 SV=3
Q2KJY2	Kinesin-like protein KIF26B OS=Homo sapiens OX=9606 GN=KIF26B PE=1 SV=1
Q9ULI4	Kinesin-like protein KIF26A OS=Homo sapiens OX=9606 GN=KIF26A PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001527 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00225 all species →	Kinesin	Kinesin motor domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR001752 all species →	Domain	Kinesin motor domain	Interproscan
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR027640 all species →	Family	Kinesin-like protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21608 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003777 all species →	Molecular Function	microtubule motor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_022682-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022682-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

21.7Max TPM

6.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.90	11.14
polyp at pH7 6	18	18	5.15	9.91
coral polyp · control treatment	16	16	7.46	13.88
coral polyp · oil and dispersant treatment	16	16	6.89	12.25
coral polyp · oil treatment	16	16	6.83	14.20
coral polyp · dispersant treatment	16	16	10.08	21.65
Polyp	10	8	1.24	2.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.14
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.47
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.11
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.72
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.68
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.15
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.32
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.69
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.50
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.45
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.42
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.40
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.06
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.02
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.78
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.37
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.82
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.71
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.46
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.45
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.24
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.23
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.92
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.13
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.95
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.68
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.59
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.94
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.57
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.29
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.04
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.22
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.52
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.19
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.99
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.73
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.30
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.91
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.83
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.80
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.10
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.64
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.41
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.24
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.92
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.25
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.95
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.15
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.89
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.23
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.10
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.98
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.84
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.53
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.12
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.20
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.28
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.05
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.20
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.72
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.03
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.76
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.95
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.95
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.14
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.11
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.44
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.15
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.75
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.65
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.31
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.97
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.60
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.51
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.73
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.13
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.29
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.81
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.88
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.54
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.74
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.70
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.85
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.39
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.31
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.87
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.82
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.68
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.