Gene detail

Detailed information of OS493_022762-T1 in Lophelia pertusa

Genomic Location: scaffold_96:1034332...1039936
NR annotation: KAJ7330238.1, hypothetical protein OS493_022762 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022762-T1

ATGGACGCCGTCGGTGAGGAACATTTGAAAAAATGCCGCTGGGTTCGCGTTAACTGGCTTTGGTCGAAGATCGGGAGGGTAAATGTGGGAATTTTCTTGAGGTTCAACCCGGTGGTGACTCTGTTGTCAGCCTTGATAATATGGGGGTTCGTAGCCTGGTGCATGGTGGAGTCAGAAACTGCTAACATAGAGCTGGGCAAGTGGAAGATCTGGATCACAGAGAAGTTCACCTGGATGTACATTGGAACTCAGGATATCTGGGCTGTGATCATCCTCATGCTCTACTTTTCCAAGTACTCCAACATGAAACTTGGACGAGATGACGAGGAGCCAGAGTTCAACGACGCAACCTACTTCACGATGTTGTTTGCGGCTGGTATCGGTATTGGCTTGTTTTACTTCGGAGTTGCTGAGCCCATATATCATTACGTACCTGGAGTGTATGGGAACCGATATTATGGCAGATACACAGACAATCAGCTGGCACAAGATGCCATGAACTTGACCTTCTTTCACTGGGGAGTTCATGGATGGATCGTGTACGTGGTTGTTGGTCTTCTCTTGGCTTTCGTGTGCTATAGACAAGGCCTCCCTATGACTGTCCGATCCTGTTTTTACCCGCTGATTGGAGACAAGATCTACGGATGGATGGGCGATGTTATCGACATCATTTCTGTCGTGGGTACCATGTTTGGCGTGTGCACAAGTCTGGGTTTGGGTGCCATTCAGCTCAACACTGGTATCCATCGTCTGAACAACGACATCGAAATCTCAACTACCAATCAGATCATCATCATTTGGTGCGTCACCGCGTGTGCGACTGTGTCCGTCATCACTGGGCTCAAGCTTGGAATCAGACGATTGAGTGAGATCTGCTTTTCCATCGGCATGCTTCTGATGCTTGTTGTCTTCTTCTACGATGATACCTGGTACCTCTTGAACTTGTACGTGCAGAGTTTTGGCTACTACCTACAGTGGATCATACAGCTGGGCTTCCACACCGATGCCTTCGCACAAATGGGCAATTCTCAGGATAACAGGGATGTTGTCAACTGGATGAACGACTGGACTATTTTCTACTGGGGATGGTGGATCGCCTGGAGTCCTTTCGTGGGAATGTTTATTGCTAAAATTTCCCGAGGTCGTACCATCAGGCAGTTTATCAATGGCACCATGACAGCGCCAATTGTGTACTCATTCATGTGGCTGACGATCTTCGGTGGAGCTGGGATCAGCATGGAACGCAAAGCATTCCACGCCAACGTCACCTGTAATTCTGTTCTTGGAGGAAAGATGTCCACTGAAGCCTACCATGGGTTGTACCGTCTGTCCTGTCGCTCCAAGGATGATATGTGGTTTGACGTTGTTGAACAGTATGGTGACATTGGCGTAGTTCTGTCCGTGATATCTATGGCTGGCATCATCCTGTATTTCGTGACAAGTTCTGACAGCGGATCTCTAGTCATCGACTGCCTCTCTGCAAATGGTGACCCGGATCCCCCAATCATTCAGCGTGTCTTCTGGGCTCTAACAGAGGGCGCTACAGCCACAGCGCTGCTGTTCGCTGGTGGTCCAAAGGCTCTGACGGCACTGCAGACCGTGTCCATAGCAGCTGGAGTCCCTTACACCATACTGCTGTGTTTCATGTGCGTCGCATTATGGCGTGCCATCCATATCGAGGCTGGAGTCCTTGATCCCAACGGCCCAGCATTCTCTGTCGATCTTCTGGAGGTGCTCTCTAACCCCACATGCAAATCCATCGGAAAAGTCCTCATTGCCTTATTCTTCCCGTGGTATCCCATGGGGATAGCTGCTCACAGGCTCAACAATTGCAAGGGGAGTAGAGTGTCCTACATGTTATGCATTGCCATTCCATTCTACATGTGGGTTATCGGCATGGCCTTGGAACCAGCTGTAGAGGGAATTAGCTACCTGGCCTGGACAGTGTTGTTTGCGTTTTTCGCATATGGCAGTGCGATCCGTATAGGCATACGCGATAAGTATGGAATCAATGGAAACATGGTGGAAGACTTCTTTGCTGTGATGCTGTTGTATCCGTTTGCGGCCTACCAGATGGATCACCACATGAGCAATCCGCCCCACCTACCCATGGACGAAAACAACCTTGACAAATATGACGACGGAAAAGGCGCAGCATACGAGAACAAGGCCGCTGACTATCCAATGGAGAAAGTGGACACTGCGTTTTAA

Transcript

OS493_022762-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P9WPR6	Uncharacterized transporter MT0942 OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) OX=83331 GN=MT0942 PE=3 SV=1
P9WPR7	Uncharacterized transporter Rv0917 OS=Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) OX=83332 GN=Rv0917 PE=3 SV=1
P63696	Uncharacterized transporter Mb0941 OS=Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97) OX=233413 GN=BQ2027_MB0941 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000591 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04749 all species →	PLAC8	PLAC8 family	Family	Interproscan
PF02028 all species →	BCCT	BCCT, betaine/carnitine/choline family transporter	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000060 all species →	Family	BCCT transporter family	Interproscan
IPR018093 all species →	Conserved_site	BCCT transporter, conserved site	Interproscan
IPR006461 all species →	Family	PLAC8 motif-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30047 all species →	HIGH-AFFINITY CHOLINE TRANSPORT PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0071705 all species →	Biological Process	nitrogen compound transport	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006810 all species →	Biological Process	transport	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_022762-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022762-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

1,008.0Max TPM

170.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	42.13	70.04
polyp at pH7 6	18	18	68.58	191.41
coral polyp · control treatment	16	16	215.22	635.89
coral polyp · oil and dispersant treatment	16	16	404.50	1,008.02
coral polyp · oil treatment	16	16	118.70	266.98
coral polyp · dispersant treatment	16	16	267.75	810.27
Polyp	10	10	71.25	170.55

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	70.04
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	70.02
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.83
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.43
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	64.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.52
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.75
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.79
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.63
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.99
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.51
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.34
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.25
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.25
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.33
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.73
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	191.41
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	185.60
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	101.43
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	98.75
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.95
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	74.76
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.83
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	67.89
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.90
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.68
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.72
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.04
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.06
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.85
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.57
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.90
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.61
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	635.89
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	487.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	426.02
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	329.80
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	312.14
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	186.97
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	161.65
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	155.08
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	150.67
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	138.10
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	133.86
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	103.43
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	99.85
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.39
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.50
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.90
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,008.02
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	647.72
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	621.90
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	618.83
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	565.00
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	522.49
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	492.68
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	429.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	388.41
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	316.72
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	249.29
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	186.37
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	133.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	128.47
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	98.35
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.25
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	266.98
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	250.16
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	215.46
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	162.04
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	153.91
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	124.11
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	114.62
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	111.35
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	99.98
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	96.03
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	89.06
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	86.91
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	74.89
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.17
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.74
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.79
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	810.27
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	558.65
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	378.54
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	325.98
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	318.76
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	317.38
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	272.60
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	219.25
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	171.97
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	167.99
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	164.02
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	156.34
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	139.41
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	134.41
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	129.03
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.37
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	170.55
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	144.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	80.60
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	68.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	66.75
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	53.29
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	47.74
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	40.23
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	37.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.02

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.