Gene detail

Detailed information of OS493_022871-T1 in Lophelia pertusa

Genomic Location: scaffold_98:366425...425837
NR annotation: KAJ7384240.1, Sortilin- receptor [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_022871-T1

ATGAGTATGACTACAAACAGTGGGATACCATCAGATAAACAGAACGGGACTTGCTTGTTAGGAAGGAAGACTATTTACAAGAGGCGGATTGCTCATGCACACTGTTACAATGGTTATGACTATGATCGTCCAATCATGCAACATAATTGCCCATGCGATAGAGAGGACTTTGAATGTGATATGGGATACCGGGATACAGATTATAATGAGTGCGCATTTGATACGTCCAGTGGTTTGACTCCTACAAGTGTACCTTCCTTCTGTCCTGTAGGCAGCACATACCGCCGCACTAAAGGATATCGCAAGGTTGCTGGTGATACCTGCCAGGGAGGCATGAAAGATCAGTTTTGCTGCAGAAACAGTTTCTTGTCCGATACATTAATCACACTAGGGGATCATATAGAAACTACCATTCCACTTGGAAGTGGGCTGCAAAATGCCATCGCATTAGACTATGATTACAAACAAAATTGCATCTACTGGGCTGACATCACTCTGGACACCATCAAGCGCACATTTCTTAATGGATCTGAAATTGAAACACTCCATGGTGGCATCCAGCAGGTGGAAGGCCTGGCACTAGATTGGCTCGGCGATAACATATATTGGGTAGATGCTGCCGCCAAGAAGATAGAAGTCTCTAGGGCAGATGGGCGTTTCCGCAAAACCCTTTTCACCAATCTTGATCGCCCCAGGGCTATTGTTCTGGATCCCAAACGTGGTTACATGTACTGGACTGACTGGGACACCAATGCACGAATAGAGAGGTCATACATGTCTGGCACAGGACGTGCAGTAATCATATCAACTAATCTACGGTGGCCCAATGGCATTGCCATTGATTTTCCTGCACAAAAGTTGTACTGGACTGATGCCGGTTTGGACAAAATAGAGAGGAGTAACTTGGATGGAAGTTATCGACAGACAATAAGCAGCACAGGGCTGCCTCACCCGTATTCAATATCTGTTTACAAAGATTCCATCTACTGGGGTGACTGGACAACACAGTCCATCCAAAAGGCAAACAAACGAGATGCTGGTGCTCGACAGACTATCAGGTCACATGTACGTGGGCTAATGGATCTAAAAGTTTTCCATCAAGATGCCCAGACAGGTGACAACTCCTGCTCTCGGCTGAAACAATGCACTCACATCTGCTTAGCTGTGCCAAATAGCTATACCTGTGCTTGTCCTGATAACATGCGAACTGTGACAACTGCTTCTGGAATTGTGAGCTGCGAGTGCCAGCCTGGGGAATACATGGACCCAAATGGAGAATGTAAAACTCGGAGTGAGTACTTAACTGTGATCGCAACAGCACCTATAACACCTGCAGCCCAACACAGTTCAGATGTGACAATGGTCGCTGTATATCTGCATCATGGAAGTGTGGATCATGACGACGACTGCCATGACATGTCTGATGAGAGAAACTGCACCTTTCCAACTTGTCAGTTGGGCCAATTTACTTGCGCTAACAGTCGCTGTATTCCACAACGCTGGGTTTGTGATTTTGACAATGACTGCCGTGATGGCTCTGATGAGCAAGGATGCACTCCAGCCCCAACTATATCACCACCACCAGCAGACTGTTCATCCACTCAATTTGCTTGCCACAATGATCATTGCATTCCAAGTTCTTGGTACTGTGATGGGGACCAGGACTGTGGTGACGGATCTGATGAGCCATCCAATAATTATTGCATCTCTACAAGAAAATGCTCCCCATCGCAGTTCACTTGTCAAAACAGACGCTGTATCCCAAGTTCATGGCATTGTGATGGTGACAATGACTGTTTGGATAACTCAGATGAACAACACTGTACATATACAACTCCGATTACTGCTTCCACGGCGACACCATGGACCCGCCCTACAAGCTGTAAAGCGTATGAATATAGATGCCATAATGGCTTCTGTATTTACCAGTGGGATGTATGTGATGGTGTTGATGACTGTGGCGACAACTCAGATGAGTGGTATTGTGCTACGACACCAACCCCGGCTCATAATGCCACCACACCATTTACCAGGCCTTGCCACTACTGGGAATTCACTTGCCCCAATGGCTGGTGTATCAACAGTGGATACAGGTGCAATGGGCGGGACGATTGTGGAGACGGAAGTGATGAGAGCGGATGCTCTTATCTTACAGCAACAGCAAGGCTCACTACTACATCGAATCCATTGTGCCCGGCTGGGTGGCTCCATTGCGGGGACACTAGCTATGTCATCTGCATAAGAACGGAATGGTTGTGTGATGGGGTAGATAACTGTCCTGGAGGCTGGGATGAAAGACCACAGAATTGCCCAAAAAGCACAAGAAGACCTATTACTTGTTCAAGCAGTGAGTACCAGTGTACAGATGGAACTTGTGTACCACTGAGGTACCAATGCGATGGAATCAGACAATGTATTGATGGCTCAGACGAGGTTGGCTGTGGTGGCGGTACTCCAAGCACTTGCCCAGACTTTTTGTGTGATTCCAAAACTGTTTGCTTGCCACTCGCACGAAGATGTGACCATATGCCAGACTGCAAAGATGGCACTGATGAAAAGAATTGCAGGCTGTTAGTCTGCACTCTGTTATCTGTGTCAGATAATTGGCATCAGGAGGACACACAACACAACAATTTTTACATTGTTTCCTATCTGCAGCCATGCTCAAAATACGAATTCGGGGTACAAGTCCTTTTAAGTGGATCTGCACCAGGACCATTATCAACTACCATCAAAACAACAACTCTAACAGCCAAAACAAGTGCTCCTCGAAATGTGCTACATGTATTGAAAGGTGATGGTTCACTACAGATAACTTGGGACGTTCCATTAACTACCTGCCATGTGGTCACTAATTATAAAATCTTTTACAAGCAAATTACTCGCATTGGATTTCAAATAATAGAGACTGGTAATGTTCAAGTATACCGTATAACAGGGCTTGCAGGAGGTGTAACATATGAAATCAAGCTGCAAGCCTTCAGTGTTGATGGTGGTGGTGACTTGTCGAATGTTCAGTATGTGCGGATTCCAATTATACCGACACATCCAACAGCACCAGTGCCAAATCCTCATTATACATCTGTCAATGCAACAACAGTGGTTCTTGCTTGGGGAACTCCTACACAGACTGGTGTCATGGTGCCTGTTTTGGGCTATAAAGTGTATGAAACAATGAGCGGTGGCCTGGTGCTCCTTATCATTACTGATAAGCATAACTACACTGTTTATTCGTTGCTCCCACGAACATCATACTCTTTCACAGTGAAACCTTACAATCAGATAGGTGATGGTCCACCTGCTTTTATTGCAGTAACAACTACAGGAGGAAGTGCTCCTCAAAGTGTAATTGCAACTCCACTTAACAGCACAGCCATAACACTAACTTGGTCACCACCAAAGCATGGCCAGTCAGGTGAACCGATGTACTACATCTACTATGGAACCTTAACAAGCGGAGTCAGTACTCGGCCTGTGGGTCATACTGCAGCTACAACATTCGTGGTGGGCCACTTGCAGCAGGACTTTGTTTATGTGTTTGAGGTGTCCTTGGGTTTGACAGGGCAGCACAGCGATCCAGTTAATTCCAAGCCAAAATCTGATGCTGATTACCAGCCGGTACACAGTCTGAAGGCTGTCGTTGTTAATTCCAGTAGTATTGTTCTGACTTGGCAAAAACCAATAGACGTAACCCTCAATGATATCAAAAACTACCAGATTAAGATGTCATTGATGGATCAGACTTTCACTAAAACCACTAAAGGCAAGGAAACTACCTACACATTTAGATACCTCCATTTTAATGCCAGCTACACTTTTGAGGTGAGGACAATATTTGTCAAACGGGACCTTGGTAAGGATGTCAGTATTGTCAAAACGACAGGCCCGTTCTCAGCTTCTGTGGGACCGTTGAGGAAAACAATAGAGGACAACACTGTTGTGCTGTCTTGGTCTGCACCGCGGACAATTTCTTCGACGGATTTGAAGCACTACAAAGTCTTTTCAACATGTCCTGGATGTTACAACAAGCTTACTCCACAGTTAACTGATAAAACGACTATAAAGTTTCCGAACTTGCAGCGAGGCCAAACATATACATTCTCCGTCCAAGCAGGAACCGCATATGGTGCTGCACAGAACTCCACCACGTCAGCCACAATAAATCTCTTCTTCGGCCAAGTTGGTAATTTGAGACAGTCAATTTTGAATAAGACGGTGACGCTTCAGTGGGATGCTCCAACTGATGTGGACGCCAAACATATTAAGGTACCTTCTGTCGTTCCTAAGGGAAAACAGGCAAATATCAAGGTCACTGTACCACCCCTCGATCTAAAAGTGAGGTATGCCGGTGGATCCCCAGGTGGCAAGTATGGATTGACAGTAAACTTGTACTGGGCAAGGATTTACGACAGGAACGTGCAATACGAAGTGAGATGGCATTGTATCAGAGGCCATGGTTACTGTTATTGGTATGATGGGTATCCCTGGAGCATGACGACTGTGAACACAACGTCTGTAGCTCTGAACATGACCCACTATGGTGTAGCATACTTGTACGAAGTGCGAGTGGTGACATCCCAAGGCAGAGGAGAGCCCTATCAAGTGTATGTCTATGTTCCTCAATTCAATGGAATGCCTAAGAGGTTTACTTGCACCGCCGCATCATCTCACTCTCTTGTGTGTCACTGGCTACCACCCACTGATTTTAATCCATCTGGATTTTATCACTACAGCCTGAAGTATAAGTGTGATGACTGCCTCGTTAGTTCCATGCGATACAAATCAGTATATGGGTTCAATCAAACCTCGGTAAACATATCTGTAAACAGTGGAGCGCGCTTCACGGTGTGGATCCAGGTGCATACAAGATATGGATTTGGAAAATGGGTTCAAACAACGGCAACTACGCAGTCTTCATTGGGAGCAGTTAGAGCGTTGGCTGCTATATTAGACGATAAAGACCATACTCTTGTTCACTTGTCTTGGCTACCTCCATCCTATAGTAGTGGTGTTCTGGTAAGCAACTTTGTCTTGTAA

Transcript

OS493_022871-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O88307	Sortilin-related receptor OS=Mus musculus OX=10090 GN=Sorl1 PE=1 SV=3
Q98930	Sortilin-related receptor (Fragment) OS=Gallus gallus OX=9031 GN=SORL1 PE=2 SV=1
Q95209	Sortilin-related receptor OS=Oryctolagus cuniculus OX=9986 GN=SORL1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000636 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00058 all species →	Ldl_recept_b	Low-density lipoprotein receptor repeat class B	Repeat	Interproscan
PF15901 all species →	Sortilin_C	Sortilin, neurotensin receptor 3, C-terminal	Domain	Interproscan
PF00057 all species →	Ldl_recept_a	Low-density lipoprotein receptor domain class A	Repeat	Interproscan
PF00041 all species →	fn3	Fibronectin type III domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003961 all species →	Domain	Fibronectin type III	Interproscan
IPR002172 all species →	Repeat	Low-density lipoprotein (LDL) receptor class A repeat	Interproscan
IPR000033 all species →	Repeat	LDLR class B repeat	Interproscan
IPR023415 all species →	Conserved_site	Low-density lipoprotein (LDL) receptor class A, conserved site	Interproscan
IPR036055 all species →	Homologous_superfamily	LDL receptor-like superfamily	Interproscan
IPR036116 all species →	Homologous_superfamily	Fibronectin type III superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR051221 all species →	Family	Low-density lipoprotein receptor-related	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR031777 all species →	Domain	Sortilin, C-terminal	Interproscan
IPR011042 all species →	Homologous_superfamily	Six-bladed beta-propeller, TolB-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22722 all species →	LOW-DENSITY LIPOPROTEIN RECEPTOR-RELATED PROTEIN 2-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006898 all species →	Biological Process	receptor-mediated endocytosis	Interproscan
GO:0016324 all species →	Cellular Component	apical plasma membrane	Interproscan
GO:0042562 all species →	Molecular Function	hormone binding	Interproscan
GO:0043235 all species →	Cellular Component	receptor complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_022871-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_022871-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

19.3Max TPM

5.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.05	15.53
polyp at pH7 6	18	18	6.15	13.36
coral polyp · control treatment	16	16	6.00	19.27
coral polyp · oil and dispersant treatment	16	16	5.30	11.69
coral polyp · oil treatment	16	16	5.52	12.12
coral polyp · dispersant treatment	16	16	4.63	10.97
Polyp	10	10	2.57	9.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.53
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.13
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.60
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.41
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.03
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.72
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.50
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.24
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.71
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.34
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.27
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.11
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.45
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.98
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.36
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.29
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.36
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.33
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.51
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.14
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.16
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.83
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.36
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.17
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.35
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.67
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.30
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.62
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.49
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.98
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.79
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.58
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.27
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.40
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.55
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.46
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.97
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.54
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.06
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.70
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.48
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.41
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.76
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.86
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.47
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.90
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.84
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.28
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.69
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.04
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.02
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.34
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.48
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.93
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.34
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.76
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.35
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.00
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.73
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.62
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.29
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.58
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.12
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.59
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.14
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.80
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.93
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.20
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.55
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.55
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.21
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.53
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.70
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.45
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.97
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.01
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.73
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.01
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.11
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.71
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.00
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.69
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.08
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.02
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.69
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.74
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.25
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.24
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.73
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.09
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.26
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.06
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.90
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.70
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.44
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.13
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.04
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.40

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.