Gene detail

Detailed information of OS493_023092-T1 in Lophelia pertusa

Genomic Location: scaffold_100:397624...399816
NR annotation: KAJ7371754.1, TPR and ankyrin repeat-containing protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023092-T1

ATGCGGGGACGCATCATTGACAAAATTCGCATGTTAGCTAATGGCAGATGGAACAAAACTCTGTGCAAGAGACTCGAAGGTGAAGCAAAGAAAGAAGGCATCCAGCTTTATGAATCAAAGTTGACCAAAGGTCAACGAATAATTTGGGAAAAGACAATCGCCTTTTCTGGTAGGTGCAGTGAAAATCCTGAGCTCCGTTTAAACATGGGAAATGCTGAGGGTCGAATCTACTCAGATATCATTCGAGTGTGGGACATTGTATTAGACCATGACAAACTTCAACGCTCGATAGAACACATCGTGAAGTCACACGACCGAGGAATGGATTGTATCATTAAGAAGAAACTGAAAGGTATTACTGTGGATGCCCGAAGCGATAGTACATCATCAAGCGAGTGTCTACCCAACAAGTACGCAGAGATAGCGGATCTGGAGCAAAGAAACAATCAATTAGTCACGAAAGATGTTCCAAAGAAGCCAATCGATTTGTCTCAGATGTTCTTTCCACCTGCGAGCGCAAATGAACAAGAATATCATATTCTCAAGTTTTACTCGTTTAATACAGCTATGGTGAAGACAGTTCTCGAGAGTGATACTTCTTCGAAGATTGATTTTCCCTTCAAGATAACAGAGCTCGAGCATGCCATTGTTAACCTCCGTCCAGATCCACCAATCCCAATCATTCTTCTGGGTCGGAGTGGTACAGGCAAGACAACTTGCTGTCTCTATCGCCTTTGGGATAAGTTTCAAAGGTACTGGGAGAGTGCTGTAACTGCTGGCCCCCACATTGCAAGGTATGTGCCTCCAGTGGAAGCCACTAGATGTGGCGACGAAGAAGAATACCTAAAAAATACAACAGAACAAGGGGTAGACCAAGGAGCATGTAGCCAGAACAGAACAACAATGGATTCCGAATATTCTGGTGTTAGTTCAGGTGCACAGAATGACGACCAAGTTCATACGTACCTCAGTTCATATTCTCACCTTCCAGAGGAAGAAAAGCAATGTGAAGAGAATATTCCAGACGATATGAACCAACCTCAGATGTGCGAACACTTGCACCAGGTATTCATCACAAAGAACACCGTTCTCTGCAGCGAAGTTGAGAAAAATTTCAAAGAGCTTTGCCATGCATGCCCAGCAGCAGAACATCGCGAAACGTTCTTTAAGCGTGCTGCAGATGGAAGTCTACGTCGAAAAATCGCAGGCTGGGGAGAAGAAGATCATCATCTTCAATTCATTCCAGCTACAGAATCGGACGACGAAAGTGATAACGAAGAAGCTGAAGACGAAGAAGTGACTGGAACTGAAAAAGGTAACGAAGAACCAAAGGAAAGAAAGAAAGAACCGGCTAAAGAAGAAAGAGACCCAAGGAGAGAAATTACGTACCAAGTTTTCCAAACGGAGATATGGCCAAAGATGAAGAAGTCCTCGAAGGAAAAAATTGAATACCACCCAACCTTGGTGTGGACGGAAATACGGTCTTTCATAAAAGGTTCTGCTGAAGCTCTGTTGTGTGAAAATGGAGTGCTTTCACTTGAAGATTACGAGTCTCTAGGAAGGAAAAAGGCGCCAAACTTCTCTGCAGACAGAAAAGTGGTATACGATCTGTTCCGTGTGTATCAACGAGTGCATTCCTCAAATCGAATGTTTGACGAAGCAGACTTGGTGTTCAACATTCACCGTCGTCTTCAAAGTATTCCTGCACCTGAGTGGTCAGTTCATCAGTTCTATGTAGACGAAACGCAAGACTTCACACAAGCAGAATTATCTATCTTGATTCGTTGCTGTCGTTTTCCAAACGACTTGTTCTTTACCGGGGACACGGCACAGAGCATCATGAGAGGCATTGCATTCCGCTTTGACGATCTAAAGTCTTTGTTTCATCACGCCAAGAAGGCGGCCGGCATCAAGGAGGGCCATCACAATTTTCATCATGGTCCCAAAGAGGTTGTACCAACTAACACACAACTATCGATCGCATGCTGGAATTCTGCGTCTGGCCTCCAGTGTGGTCGATTTGCTGCTGCATTACTTTCGCGACTCATTTGA

Transcript

OS493_023092-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BV79	TPR and ankyrin repeat-containing protein 1 OS=Mus musculus OX=10090 GN=Trank1 PE=2 SV=3
O15050	TPR and ankyrin repeat-containing protein 1 OS=Homo sapiens OX=9606 GN=TRANK1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000903 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00580 all species →	UvrD-helicase	UvrD/REP helicase N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR039904 all species →	Family	TPR and ankyrin repeat-containing protein 1	Interproscan
IPR014016 all species →	Domain	UvrD-like helicase, ATP-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21529 all species →	MAMMARY TURMOR VIRUS RECEPTOR HOMOLOG 1, 2 MTVR1, 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023092-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023092-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

105TPM > 0

7Conditions

9.0Max TPM

1.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.62	8.97
polyp at pH7 6	18	16	1.43	2.60
coral polyp · control treatment	16	16	2.54	6.53
coral polyp · oil and dispersant treatment	16	15	1.35	2.43
coral polyp · oil treatment	16	15	1.70	4.78
coral polyp · dispersant treatment	16	15	1.86	3.55
Polyp	10	10	0.74	1.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.97
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.13
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.64
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.23
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.98
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.93
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.89
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.62
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.59
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.48
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.32
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.64
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.45
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.26
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.26
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.60
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.07
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.04
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.02
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.66
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.43
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.35
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.13
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.99
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.95
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.48
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.47
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.53
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.53
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.10
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.77
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.41
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.63
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.23
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.17
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.84
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.81
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.78
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.76
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.25
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.43
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.02
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.92
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.90
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.53
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.50
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.42
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.36
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.28
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.22
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.08
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.87
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.71
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.44
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.78
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.35
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.95
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.09
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.08
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.79
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.72
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.54
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.14
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.13
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.90
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.76
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.53
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.35
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.20
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.05
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.02
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.58
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.51
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.26
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.75
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.68
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.46
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.85
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.67
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.59
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.91
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.07
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.90
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.84
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.79
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.62
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.47
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.17
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.05

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.