Gene detail

Detailed information of OS493_023109-T1 in Lophelia pertusa

Genomic Location: scaffold_100:505207...514947
NR annotation: KAJ7371771.1, TPR and ankyrin repeat-containing protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023109-T1

ATGAACTGTGTACCACAGACGACAGGGACTATTGATAAACTGAGTTCAGTGTTACTCAGTAACCGCTGTGCTGCGTACTTGAACCTGGAGATGTATGACAAGGCTCTGGCAGATGCTAAACGATGTGTTCAGATAGAACCAGAATGGTCTAAGGGGTACTACCGTCTTGGTTCATGCTTGAACTTCCTTGGTCAGAACTCAGAGGCATTGACAAATTTCTGTGATGGACTGAAGAGAGCTGAGACAGATGACGATAAGTTTGCTCTTGCATCACACATTATCTCTACAGCGATGGATCTAAACGATGGAACTCTTGGAATAACTTGCCGCATTCCCAGAGCCGCAGTTCAAAGGCTGATCAAGGACGTGTGCTCCAAGAAAGAATGGGACAAGCTCCACTTGTTATTCCTCGGCGGTGACAGTCAAAGGTCGTATGCGAAGGGCCGTGGAGGTGTAGCGACGGGATGTAATGCTGGTATTGTTCCCATCAACCAAGTGCTTGAGTCGTCAGTTAAAGACCGCGACAAACTGATCGCTGTGCTGCTGGATCACGGTGCTATTGCTAATGGGCCACATGGGTGTAAAAATCCACCATTGTCTGTTGCTATGGAGATGGAAGACTACGGTATTGCCTACACCCTTTTAAAGCATGGTGCAGATCCATCAGTGATTGGTTGTTATAGAGGAGCATCTTCGCACCACCGTGAGAATCAAGGTCATTTCTGGAAAGAAGAAGGAGTGAAGGCTCTGAGTACGAAGGACTACAGTCGAGCTATCAAACTGTTGAATTTATCGCTTCAGTTTTCTAACAATTCAGCCGATTTGAGTTACCTTGTGAACAACTCTCTGGCGACTGCATATTTTGAAACAAAACAGTACGTCAAGGCTGTGGAGAAAGGCAGAGAGTGCTTCAAGTTCAAACCAACAAAATCACAGACTGAGGCAAGTAAGTGGAAAGAGCGTGGTAAAAGACTGTTCTCCGAGAAGGAATTCTCCATTCTAGTGGAATATTATACGCTGTCTATGCAGCTTGTGGATTCTAAGAGCTGTACAAGATTCAGGCCAGAGTGGTACAAGGGGTTTGTGCGGCAAGGATACTGCCATGCCTGTTTGGATCAGAACAGAGATGCTGTCAGAGCCTTTGGTGAAGGATTAAAACGAGCAGAAAATGACGAAGACAAGTCTGTTGTACTTTCTCAGATCGTTTCTTTGGGCCTAAATCTTCCAGATGTAACCTCCAGCATAACGTGTAGTGTCCCAAACCACATTCTGGAGAAACTCATCAAGCAGCTTGCAGAGAAAAAGGCCTGGGACAAGTTACACGTCCTATACCTAGGGGGTGGAGGACCACAGCGATACTCACCAGGGGAGGGTGGCTTAGCAACTGGTATCGACGCATCAAGAATTCCTATCGAACTTGTGTTTGAAGCTGGTGAAAAGTACCGAGTCCCTCTCATTATGGCTTTGTTGGAGAATGGCGCATTCTCTAATGGACTCAGGAAGACAAGCAAGAGTCCTTTGGAACTGGCCATGGAGGATGAAGATTACAACATGGTGGTCACACTGCTGCAGTACAATGCTGATCCAGCCTGTATCATGTCAAAGCCTGGTGATTCACTTCTGCATGAGGCTTTGAAGCAAATGTTTGCAACAGGTAACTATGGATTGATTCAAGCCTTACTTGATTCGGAGCTGTTTGACCCTGACATGGTAGATGGCAGTGGAAATACTCTCTTCCACTTGGTGGCTTTTGGCAAGGCTTCCAGAAAGAAGTGCGACATGATTAATATCCTGGCAGACGCAGGTGCTAACCCAACACTGAAGAACCCAGACGGCAAGTCCCCGGTGGACTACCTCACCAAGAAGGACCCTCGAGCAAAGCTCCTTAGGGCAACTATCAACTCGTACATGAGTGGCAAGAAGTCCGGTGGTGCAAAGAGAAGGAAGAAAGTGCTGAAGACGCCGAACAAGGCAGTGGCACAACACGTAACATCCGCGCAGGTTCAGGAAGAAGCAGAACCAGACTGGTGTAAGCTTGCAGATGCAGCAGCTCTAGATGATGAGGATCAAGTGTTGGAAGTGAAAGGTAAAGACAAGAAGCCTATGCCTGCAGCCTTGCCGTTGAAGAGGGATCCCTTGGATGACCTACGTGCGAGCATCAGGGGCATAATTGAATGCATCTGTGCTGATAATTTACTTGGAGGTGAAGATAGAAATGCTGATGGCGCTGTAGACAGGAGAGTAGTGAAAGCTGCTGGAAATGATACCAAACAACCACAGATTGAAGAAGAAGAGCCTGTCTCGCATCCTGTTCCAGATATCGAGAGAATCCAAGATGACGAGGATGATGACGACACAACTGAGGAAGAGCTCGAGTTAGATCTGGAGTCTCCTTTTGAGGACTTGCCTTGGGAAGTGGACTGCACGGACCAGTTCTGGAAAGCTCTACAGAACACTAATGTCAGTGATGCCTTGAAGCGTCGCATTATCGCCAGGATTCGCATGCTAGCCGAAGGTCGATGGACAAGAAAGCTCTGCAGGAGGGTCGATGGATTGTCCAAGAAACGCAACATCATGCTGTTTGAGGCTAAACTGACAAGAGCCTCAAGAATTATTTGGGAACTGACCGTTGCATTCTCAGCCAAGTGCAGTAACGATCCAGAAATAAGAATGCAAGCGGAGACGCGTGCTGGCCGGGTTTACTCCGAGATTATCCGAATTTGGGACGTAGCTGCCGACCGAGACACCCTTATGACGAAAGTTGAAGGCATCGTGAAATCGCATGATCGAGGATTGAACTGTATTGTAAGGAAAGAGCTGTCTGGATTCAGAAAAGGCAATGATAAAGTGAAAAATGCCAGTGGAGAACGTCTTCCAAACTTCTTTGTTGAAGTGTCAGAAAAGGTGGAAGATTTCCCTCTGGAGAAAACAGCAAAGATGCAAAAATGTTCTGATAAAGGCAGTGGCTCGCAGTATTTTTTCCCTCCAGCAAGTCCAAATGACATGGAGTTCCACATTCTCAAATTCTACTCGTTCTCGTCAGCCTTAATCAGCTCAGTTCTTCACAGTAATTATGCAACCAAAGTGGACTTTCCCTTCAGGGTCACTGAACTTGAGCATGCTATTATCAACCTGCACCCAAGTCAACCATGTCCAATTATTCTACTTGGTCGAAGTGGAACTGGAAAGACAACCTGCTGTTTATACAGACTTTGGAACGAATTCCAATCTTACTGGGAAAAGGCAACCACTGCAGGCCCACATATTCCTAAACTGGTTCAATATTTACCCAAGGCAGAGTCATGTGGAGGTTTTACAGTTTGCGAGCAGCCTGATGATGGATTGTTCCTTGACTCGTCAAGTGCCAGGGTTATGGAAGACGTAAAACCGTCCCCATCTGAGGAATTTGTGCGAGCGAAAGATGCACGGCGCAAAGACTATGAAGAAGGTGATGAGACGGTAGAACCATCTGAATTTGAGGAAGAGGATGCCCTACAATACGAACATCTGCATCAAGTCTTCATCACAAAGAATCCAGTGCTGTGCAGTGAAGTCCAGAAGAACTTTTCCGAGCTCAGCCATGCCTGTCCTGCTGCAAGAGAACATGTAGAAAATGAGGAAATGCTACTGCCTTCCAAGATTCAAGATATTGCTGACGCAGCGTGGCCCCTGTTCATAAACTCCCGTGACTGGTTGCTCTTGTTAGATGCATCTTTACCAGGCTGTGAGTTCTTCCCTCGCACCGAGGACGGCAGTCTGATGAGAAAGATTCATGGCTGGGGAGAAGAGGAGACGCATCTGGTCGCAATTGATGAAGATTCTGATAGCGAAGCTGAGGAACAAGATGAGGCCACAGCCGAGGAAACAGATGACGTTGTCTATGGTCGACACGACCCCAAGAGTTTTGATCCCAGGCGTGAGGTCACCTATGTAGTGTTTGTATCAGAGCTGTGGCCTCGGATGAGCAAGAAAGTGAAGGTCCAGTACCACCCGACTCTGGTGTGGACTGAAATCCGCTCGTTCATCAAAGGATCCATAGAGGCTCTGCACACAGAACAGGGTTACTTGAGTTTGGAAGAGTACTCGGATCTTGGACGCAAACGGGCTCCAAATTTCTCTGCTGATCGGGGAGTGGTGTACTCCCTCTTTGTTGTCTACCAGAACACCAAATGTTCTTTGCGGATGTTTGACGAAGCCGACGTCGTCCACAATGTTTACACTCGCCTGCAGAAAGTCCAAGTTCCAGATTGGTCAGTTCATCGCTTCTACGTTGACGAAACGCAGGATTTCACTCAAGCTGAACTGTCTTTGTTGATCCGCTGCAGTCGCGATCCTAACGGACTGTTCTTCACTGGTGACACAGCACAAAGCATCATGAGAGGAATCGCCTTTCGCTTCAACGATCTAAAATCTCTGTTCTTCTACTCGCAGCAGTCCTACCAAGCACTTGGCTTCCAGTCTGGAGTAAGAGTTCCAAACAGACTTTACCAGCTGACTCACAACTACCGCTCACATGCAGGCATTTTGCGGCTTGCCTCGAGCGTTGTGGATCTGTTGCTTCATTACTTTCCAGAGTCGTTTGATCGTCTTGAGAAGGATCAAGGCTTATTTGAAGGACCAAAACCGTGCTCCTAG

Transcript

OS493_023109-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O15050	TPR and ankyrin repeat-containing protein 1 OS=Homo sapiens OX=9606 GN=TRANK1 PE=1 SV=4
Q8BV79	TPR and ankyrin repeat-containing protein 1 OS=Mus musculus OX=10090 GN=Trank1 PE=2 SV=3
Q96AY4	Tetratricopeptide repeat protein 28 OS=Homo sapiens OX=9606 GN=TTC28 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000890 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_023109-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR039904 all species →	Family	TPR and ankyrin repeat-containing protein 1	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21529 all species →	MAMMARY TURMOR VIRUS RECEPTOR HOMOLOG 1, 2 MTVR1, 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023109-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023109-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

45.9Max TPM

5.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.61	11.75
polyp at pH7 6	18	18	5.39	9.11
coral polyp · control treatment	16	16	7.65	45.86
coral polyp · oil and dispersant treatment	16	16	6.20	38.98
coral polyp · oil treatment	16	16	4.32	7.25
coral polyp · dispersant treatment	16	16	3.39	7.06
Polyp	10	10	2.58	8.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.75
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.94
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.48
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.38
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.37
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.92
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.75
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.70
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.69
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.77
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.27
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.11
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.69
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.66
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.11
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.82
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.78
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.66
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.72
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.59
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.80
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.60
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.37
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.82
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.30
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.90
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.81
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.53
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.03
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.94
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.19
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.07
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.64
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.59
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.08
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.44
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.86
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.74
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.57
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.76
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.75
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.27
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.56
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.98
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.26
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.87
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.51
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.57
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.21
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.01
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.54
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.13
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.94
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.88
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.77
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.98
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.25
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.21
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.54
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.43
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.35
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.79
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.02
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.15
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.29
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.63
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.63
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.56
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.52
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.00
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.83
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.06
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.01
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.86
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.21
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.04
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.97
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.72
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.71
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.62
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.33
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.73
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.65
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.57
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.04
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.73
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.60
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.36
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.99
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.36
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.80
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.99
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.48
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.36
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.17

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.