Gene detail

Detailed information of OS493_023160-T1 in Lophelia pertusa

Genomic Location: scaffold_100:1046898...1059119
NR annotation: KAJ7371819.1, hypothetical protein OS493_023160 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023160-T1

ATGGCCCGTATAACCAACAACATGGCGGCGACCATGAAATGGAAGCGTGTGACAAATTCTACCGGCCCTGTGCCGCGGCCAAGACATGGACATCGCGCCGTAGCAATAAGAGAATTAATGGTTGTCTTTGGCGGTGGAAATGAGGGAATCGTAGACGAGTTACACGTCTACAACACAGCGACGAATCAATGGTTTGTTCCTGCCGTTCGAGGAGATATTCCCCCTGGTTGTGCTGCGTACGGCTTTATTTCCGAAGGAACACGGCTAATTATATTCGGTGGAATGGTGGAGTATGGAAGATATTCGAACGAGATGTACGAGCTACAAGCCAGTAGATGGGAATGGAAGAAGTTGAAAGCAAAGGGACCAAAGTCTCCAGGGGCGTACCCATGTCCTCGCCTCGGACACAGTTTCACCGTTGTTGGTCACAAAGCCTATCTGTTTGCTGGTCTGGCCAATGACAGTGAAGATCCAAAGAATAACATCCCCAGATATTTAAATGATCTTTATGTCATTGATATACGGAGCACCAATAATTTACAATGGGAGATGCCCTCGACATTTGGCGTGACTCCGTCTCCACGAGAGTCACACACTTGTGTCGCTACGTCTGACTCTGACAATAAGAGAGCCAGGCTTATTGTGTATGGTGGAATGAGTGGCTGTCGCTTGGGCGATCTACATCAATTAGATATTGACACAATGACATGGTCCAAACCAGCTATCCATAATATGATTCCTCTTCCGAGAAGTCTTCACTCTGCCACCACTATTGGCAAGAGAATGTTTGTGTTTGGAGGGTGGGTTCCGCTTGTAATGGATGAAGTGAAACCTGGACGACAAGATGAGAAAGAGTGGAAGTGCACAAACTCTCTTGCATGCTTAAATTTAGAAACCATGACCTGGGAGAATGTGGTAATGGATCAGTATGACGACTCCATTCCGAGAGCACGGGCAGGACACTGCAGTGTAGCTATCAATACTAGGCTGTACATGTGGAGTGGCAGAGATGGTTACAGAAAAGCCTGGAATAATCAGGTGTGCTGCAAAGATTTGTGGTATCTTGAAACAGAAAAACCACCAGCTCCCAGCAGAGTACAGTTGTTACAGAAATATGAGCTACCTCCGACACCACCAGTCACGCCAGTCAAGCAGCCTTTCACAGCGAGTGGAACTGGAAGTACCTTGCTGATGAAATCACCGGTGTCTGGAGCAACCCCTCCAAAGGGAACTGTGAAGGCATTTCCACCAAATGGAAAGATTGCTTCTTCGCCGACTAGCCACGTAGGAACACAGAAAGTTCTAATGCAATCGCCTTCACAGCCTCCTAAGCCACAAGTACCGTCTCTGATGCCACCTGGGAAACCTATGAACATCGCACAGAGGCAGAGTCCAGCTGCCAGCCCTGTGCCTGGTGTGATGAAGGCCTCTGTAGTTATGTCAACGGGTTCTTCAACTGTTCAATCTACAGCGGCAGCCACCACAGCAGTGTCTGGTGTCAAGGCAGCCATGCAAGGCCAAGCTATCAATCAAGGTCAAGCGGCTCAGGCTGCTACTTTAACCAATCAGGGGCTAACATTGTTAAGAGCGCCTGTGCAGCTTCCTCCTGGAGTGCAGGCCACCATGATCACCAACGCTCAGGGTATTCCTGTTATGCGTCTCCAAGGTGCTGGAATTCAAGGCACTGCACCCATGACCTTAGTCACAACTCAAGTTGGTGGCACACAGCTCCAGGGTGCGACTATTGTCCGCATGGCCGCGCCAATTGGTGCTACTGGCACAACTGGAGCAACAACCGGAACAGTGCTAAGATTGCCGGTGCAGAGTGGAGGGGCTGGTGTACAAGGGACAGCTGTACTCAAGATTCCTGTTACGACATCCATACAGATACCTGGCACTACTGGCTTGACACTCGCCGCCATGGCAGGGAGTGGTGGGCAGGCTGCAGTGATCAGGCAGCAGCTTCCGTTGACTGTTCCCGCTAACTTACCCCCAGGAACACAGCTCAAGGTTGGTCCACAGGGCCAGCTAACAGCTATAGGTCCAGGTGGGATTCCTGTGCAGCTTACCTTGCAAAACGTCAAAACTCAGCAGGTGGCCGCAGGACTCCAGATGCAACAGGGAGCCACTCTAGGAACACCGACAGTTCTTCAGTTAGCTGGTGCTTCACCCGTGAAGGCAGCGAACACGGCACAGCTGGTGTCTTCTTCAGCGTCACCCTCACACAAGGTCGCAGCACTATCTACCCAAGGCTCACCTGGAAGTAGCAGGCCTGTGGTAACCACCACAACAATGCTGTCAACTGCTAAACCAGTTATGACTACAACGTCTGGTACGCTAACATCAACAGCTGTTGCCAGACAGAGTACCCCTGTCAGCAAGACGACCTTGGTGTCTTCCACCCTTGGTTCTACCTCTGCTCAGGTTCAGGAAAAGAAAACTATAGCAGCCACCATCTCCGCACAAAGTCTTGTGGTTGCTGCTCCTTCACCAAGCAAACAGACCATCCCAGTAACCGCACAAACTGCAAAAGCAACTATGGCGGATACGACCACTGTTTTGAGAACAGTAACTCCAACAGCAGTATTGCCACCAAAGACAGCTCCTACAGTACTATTACCAACTAAAGCTCAGGTGTCACAGGCGTTAACGTCCAGTAGCACTGTTAGGGCAAGTGTATCCACCAGTGTGGCTACATCGAGTACGCAGGCTGTTTTTAAGACAACAGGAGCAGATACCACTACTACAGTGAAGTTGACAACCCCAGCTGTGATGGCAACGCTCTCAACTCCAACCCCAGTTCAGTCTGTAGTCAGTGTGGCCAGAGTGACGGCTGCTCAGTTAACATCACCTTCCTCCTCGATGCAGTTTTCAAGATCAGCAGTTCCAAGAGTTACGACTGCGGGTGTCGTCAAGGGAACAGCGGTGACCGGGACACCCGTGGTTTCAGCGATGACAACCCCATTAGTGTCTACATCAGTGTCCAGTAGTACACCTGTAGCTGTCGTATCTCCACTAATAACCGCGACACGGCCTGCTGCAACATCGACTGGGATTTCTCCTGCAAAGTTTTCCACTACCTCGCATCTGACGGCCACCACCAACCCATCTCTGGTTACCTCTGCTGTTGCACGCACTGTGAATGGTGGAGTTGGTGTGACGACTAATCGATCAGCGACACCTACCTTGATATCAAGGTACCAAAACCAGTCAAACCCAGTTATATAA

Transcript

OS493_023160-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P51610	Host cell factor 1 OS=Homo sapiens OX=9606 GN=HCFC1 PE=1 SV=2
D3ZN95	Host cell factor 1 OS=Rattus norvegicus OX=10116 GN=Hcfc1 PE=1 SV=1
Q61191	Host cell factor 1 OS=Mus musculus OX=10090 GN=Hcfc1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004526 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13418 all species →	Kelch_4	Galactose oxidase, central domain	Repeat	Interproscan
PF13854 all species →	Kelch_5	Kelch motif	Repeat	Interproscan
PF01344 all species →	Kelch_1	Kelch motif	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR043536 all species →	Family	Host cell factor	Interproscan
IPR006652 all species →	Repeat	Kelch repeat type 1	Interproscan
IPR015915 all species →	Homologous_superfamily	Kelch-type beta propeller	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46003 all species →	HOST CELL FACTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003713 all species →	Molecular Function	transcription coactivator activity	Interproscan
GO:0006338 all species →	Biological Process	chromatin remodeling	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0035097 all species →	Cellular Component	histone methyltransferase complex	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14966	HCFC1; host cell factor 1	-	Mitochondrial biogenesis	ko03029	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023160-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

47.6Max TPM

12.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.03	17.33
polyp at pH7 6	18	18	10.45	15.34
coral polyp · control treatment	16	16	17.78	47.60
coral polyp · oil and dispersant treatment	16	16	15.25	40.22
coral polyp · oil treatment	16	16	13.20	23.07
coral polyp · dispersant treatment	16	16	10.41	22.64
Polyp	10	10	4.04	8.12

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.33
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.27
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.89
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.95
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.24
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.54
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.33
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.85
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.62
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.09
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.93
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.69
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.60
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.27
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.37
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.55
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.25
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.34
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.42
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.17
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.07
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.04
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.29
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.92
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.75
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.07
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.89
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.22
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.13
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.15
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.59
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.30
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.91
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.60
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.05
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.42
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.18
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.85
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.17
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.85
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.99
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.33
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.51
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.95
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.62
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.77
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.55
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.74
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.22
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.07
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.64
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.59
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.94
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.85
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.08
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.19
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.58
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.14
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.89
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.85
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.56
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.84
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.65
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.66
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.77
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.61
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.51
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.74
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.60
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.68
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.02
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.78
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.54
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.65
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.88
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.90
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.23
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.64
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.47
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.96
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.83
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.48
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.29
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.31
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.78
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.50
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.74
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.43
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.33
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.78
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.12
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.79
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.01
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.75
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.67
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.60
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.68
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.57
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.29
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.93

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.