Gene detail

Detailed information of OS493_023164-T1 in Lophelia pertusa

Genomic Location: scaffold_100:1068611...1087750
NR annotation: KAJ7371823.1, Rho GTPase-activating protein 42 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023164-T1

ATGGGGCTTAAGCCTCTCGAATTCGAGGACTGCATTTTGGATAGTCCATATTTCCGCGAGAACATTCATGAACATGAACGGGAGCTGGAAAGGACGAACGAGGCAATCAAGGGGCTGATCAAGGAATGCAAGACTTTGCTGAAAGCGATTGAAAATTTATCCAGAGCACAGAGGAGTTTTTCTCAAGTCCTGAATGACTTCAGGTTTGAGTGTATTGGGGAAGTAGAGACTGACGATGAAGTAGAAATTGCTGATGCCCTGAAGGAATTTAGCAAAATGATTGATGCTGTAGAAAATGAACGAGATATCATGTTAAACCATGCAAACGCCCAGCTGATCATACCGCTGGAGACGTTCAGAAAAGAACAGATTGGAGGAGCAAAGGAGGAAAAGAAGAAATTTGACAAACAGACCGAAAAATACTGTTTAGCAGTACAGAACTACTTGAATCTTTCTTCAAAAAAGAAAGATACAATTTTGTGTGAGGCGGATAATCAGCTTCAGTTGGAGAAACGTTCATTTCATCAAACTGCTCTGGATTATGTCGTCAAACTCCAGGAGGTTAATGAGAAAAAGAAGTTTGAATTTGTGGAAACAACAAGAGAAAGATTTGATACCGCTAAAACTGAAGCCGAAAGCCTGATGGGTCGAGTTCAAATGAAAGCTCAAAGTGGTGAACTTCAGTACCGTGGAGCACACACACGACAAGGATATCTTGGCGTCCAAAAGAAAGGGAGCCTTGGCACTTACACCTGGAATAAGCACTATTGTATGTACACAAAGGAAAACAAGATTCTAACAATGATCCCGTACACACAGACTCAAGGACGACTGAATGCATCAACAGATACAATGGTTGTTACATCATGTGTTAGAAAAATGACAGACTCTATAGACAGAAGATTTACTTTTGAAATTACTGCTCTTGAAAGATCTCAACCCATTTTATTACAAGCACAAAATGAAGAGGACAGAAAGTCCTGGTTAGAAGCCATGGACGGCAAAGAACCTTTGTACATGGATTCTAATAGCCTGCCCAAGTTCAAAGACCAGGAAACTAGTGACCTTGAACTGACTTTTATCACCAAGTGTATTTCAGCAGTGGAAAAAAGAGGTATCACAGACCAGGGTCTTTACAGAGTGGTTGGAGTGGGTTCTAAAGTTCAAAATCTTATATTACAATGTATCGACAAGAAGAAAGCTTCAACAGTTGACCTTGCAGATCAGGAATGTGAGTGGGAAGTGAAAACCATCACCAGTGCCCTCAAACAGTACTTGAGAAAAGACACGTATGAGAAGAGAATAGAAGCTTTGAGATGTCTTGTGGCTGACCTGCCTGATGAAAACAGGAAATTAATCAGAATGATAATGAATCATTTAACACGTGTTGCCGCACATTCCAATAAGAATTTAATGGCGGCGAGCAATCTTGGAGTCGTGTTTGGTCCAACACTGATGAAGTCCAGAGAGGAGTCTATGGCTGCCATCATGAACTTAAAGTACCAGAGCATTGTTATTGAGCTTCTTGTCAAGGAATTTAACACAGTTTTTGGAGCCGACCCCAGCCCAGTTGTTACTGAAGACTCAACTGACTCCTCCAATTCAGTGGAAAGCACAGGGAATCCGTTTATCAACGAAAAGGAAAATTCAAAGAATGCCGTCTATGAAAAGCCTAAACCTCCGCCCAAGAAGCGAAACAGCGACGAGTCTGGCACCAAGTTGAATGAGAGCAAAATTGTGACACCTACAAAGCCTCTACCCCTCCCCTCTAAAACCCACCGTGCCCCACCCCCTCCGTCCAAGCCAGTTCCAGCGACTAAACCAAGAGTCCAGCCCATTATTGTAACAGATTCTGAGGATGATCTGAGCAGTTTGTCAGAGTCGTCAACTCCTCAAAGTGAAACCGGGAAAACGCCGCTCTCCCCAAGAGCCTTTTGGAAGGAGAAGACTGCAGGGAAACCAGCCCCGCCTCCTAAAAAACCAGAAGTGGTCGCTGAGTTTAAAAGCAGATTTGAAGTAACAGGCTCTTCAAGACCCTTTTCTATGATAGATTCCATACATGACAAGGAAAGTACTCCTGGTATTCGCCGGGTCACCAGCCTTGGCAGGGGGATGCAGTCCTGGGGGACGGGTCCTCCCCCTCTCCCTCGGGAGCCTCCTCCACACGAGGAGCCGACGCCCTCTCCAGCCACCAAAACACCCAAGAAAGTCAAGACGGTATATCCTTGTGTAGCAGAAAACAGTTCAGAGCTTTCGTTTGATGCTGGTATGGTCATTTCAAATGTGCGGCCTTCCAAAGAACCGGGTTGGCTCGAGGGGACGCTGAATGGTAGAACAGGACTGGTTCCAGAAAATTACGTTGAGCCGATAACATAG

Transcript

OS493_023164-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UNA1	Rho GTPase-activating protein 26 OS=Homo sapiens OX=9606 GN=ARHGAP26 PE=1 SV=1
Q6ZQ82	Rho GTPase-activating protein 26 OS=Mus musculus OX=10090 GN=Arhgap26 PE=1 SV=3
Q5ZMW5	Rho GTPase-activating protein 26 OS=Gallus gallus OX=9031 GN=ARHGAP26 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002545 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan
PF16746 all species →	BAR_3	BAR domain of APPL family	Domain	Interproscan
PF00169 all species →	PH	PH domain	Domain	Interproscan
PF14604 all species →	SH3_9	Variant SH3 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR027267 all species →	Homologous_superfamily	AH/BAR domain superfamily	Interproscan
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR047225 all species →	Domain	GRAF, PH domain	Interproscan
IPR004148 all species →	Domain	BAR domain	Interproscan
IPR047234 all species →	Family	GRAF family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12552 all species →	OLIGOPHRENIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20071	ARHGAP26, GRAF; Rho GTPase-activating protein 26	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023164-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

49.4Max TPM

21.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	21.04	39.31
polyp at pH7 6	18	18	19.39	28.73
coral polyp · control treatment	16	16	28.80	49.43
coral polyp · oil and dispersant treatment	16	16	21.96	40.15
coral polyp · oil treatment	16	16	23.96	39.89
coral polyp · dispersant treatment	16	16	23.30	37.42
Polyp	10	10	7.12	12.45

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.31
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.12
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.73
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.00
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.39
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.99
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.88
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.44
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.32
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.38
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.80
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.14
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.21
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.24
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.73
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.30
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.11
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.04
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.83
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.17
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.94
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.66
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.55
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.45
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.10
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.55
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.53
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.94
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.44
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.43
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.22
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.18
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.07
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.14
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.21
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.95
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.61
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.64
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.75
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.87
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.95
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.61
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.84
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.96
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.22
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.89
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.49
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.21
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.38
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.90
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.15
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.84
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.12
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.72
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.62
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.95
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.89
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.84
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.78
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.56
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.68
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.45
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.70
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.55
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.31
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.25
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.06
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.00
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.57
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.42
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.52
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.25
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.66
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.60
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.97
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.78
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.20
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.60
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.28
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.20
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.73
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.58
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.19
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.08
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.71
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.17
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.35
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.03
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.89
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.88
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.34
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.20
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.35

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.