Gene detail

Detailed information of OS493_023390-T1 in Lophelia pertusa

Genomic Location: scaffold_103:886801...919508
NR annotation: KAJ7390678.1, Sodium/potassium-transporting ATPase subunit alpha-1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023390-T1

ATGAAAAGCTTATTTTGGGCCATAACAGAGTTATTTTATGAAGACAGCTTACCATACCTGGCCTGTTTTATTCTCGTCTTCTATTACGTGTGGAGTAGCTACAGCTCATTCACCAATAAATACCAGGTTCTCGCTTTAACGTTATATAAGCATCACAAAAAGTCACCAGTTGTCACAGACCAGGAAACAGAGCGGAACACGCCCATTCCTGGCACCGTGATAAGCATTCCAAAAGAGCTTTTCGATGTGGCATGCGAACAGCTTATGCCTATCAGAGTAAGTGTGTGCATTCTGGTGTTGCGAGTAGCTTTAATATTGACCTTTGTCTTCATGGTTTTCTTCCTGGCGATGCTGTACGACCATAATTTTAGTGTTAAACCAGTGACAAGAGCTTTGCTGACGTTTTCTGAGTGGGTCGTTACCAAGATTATCGACATATTCATCAGTGATAAAGGACAGAAACACATTGAGGCCACAGCTATTGACGAGAAAGTTTCACACATTATTGAAGCCTACAATAACAGCAGAGCAACAGAACAGAACATCGAGATAAGGGCGTTTGTGACAATGGCAGAAGAAAATAATAAAGATGAACTGGGGGCTGCGTACCTTCAAGAAATGTACGAAGTCGGTGGAAACCCTGATGAGTATGGGCGGAAAGACAGCTACAGAGCTGCTACGACACCACTTGTGAAGCATGCTCCTGCTCCAGAAAAAGGCAAGAAAAAAGGAAAGAAGGATGACAAGAAAGACAAGCTGGAAGATCTAAAGCAAGAACTGGAAATGGATTGGCACAAGATACCACTTGACGACCTTGAAAGCAAGCTTAGCACTGATCTAACCAAAGGTCACACGCAAGAAAAGGCTGATGAAATCTACGAACGCGATGGTCCTAATGCTCTGACGCCACCGCCGACTACCCCTGAATGGGTGAAGTTCTGTAAACAGCTATTCAGTGGCTTTGCCATGTTGCTGTGGATTGGAGCCATTCTTTGTTTTATCACTTTTGCAATCAAAGTGTCCACGATAGAAGAACCAGAAAAAGATGATCTGTACCTCGGAATAGTTCTTGCTACAGTGGTTATCATTACGGGCTGTTTCTCGTACTACCAGGAGGCCAAGAGCTCCAAGATCATGGAAAGTTTCAAGAAAATGGTTCCACAGGAAGCCACTGTCCTTCGTAATGGGGAAAAGCACAACATCACTGCAGATAAACTTGTCATGGGAGACATCATCTTTGTCAAGTTTGGCGACAGAGTACCGGCTGATATCCGTGTCATTGAAGCTCATGGTTTTAAGATCGACAACTCTTCCCTCACTGGCGAATCAGAACCCCAAGCCCGAACAGCAGAATTCACACACGATAATCCCTTGGAGACAAAGAACTTGGCTTTCTTCTCGACAAATGCAGTTGAAGGAACCTGCACTGGAATCGTTATCCAAATAGGCGACAACACTGTCATGGGACGTATCGCCAACTTAGCTAGTGGATTAGGATCAGGAAAAACACCCATTGCCGTGGAAATTGAGCATTTCATCCATATCATCACTGGAGTTGCTGTGACCCTCGGATTGACCTTCTTTGTTCTTTCTTTGATCCTGGGTTACCATTGGCTCACTGCCGTCATATTTTTAATTGGTATCATTGTCGCCAATGTGCCTGAGGGACTTCTTGCAACTGTCACGGTGTGTCTGACCTTAACTGCTAAGCGTATGGCAGCCAAAAACTGCTTGGTGAAGAACTTGGAGTCTGTTGAGACCCTCGGCAGTACATCAACCATCTGCTCTGACAAGACAGGAACTTTGACTCAAAACAGAATGACTGTTGCTCACATGTGGTTTGACAATAAAATATTTGAGGCTGACACTACAGAGGATCAATCAGGAACTCCTATGGAAAAGACGGAAACCTGGGATGCGCTAGCTAAAATTGCAGGATTGTGTAATCGTGCTGAGTTCAAAGTAGACCAAGAAGGTATCCCTGTACTCAAAAGAGAGACAAATGGAGATGCTTCAGAATCAGCCCTGCTAAAATGCATTGAACTTCAAGTGTCCAATGTGACTGAAATGCGTGACAAGAACAAAAAGATTACCGAAATCCCGTTCAACTCAACCAACAAATACCAGGTGTCAATCCACGAGCAAGCAAATGACGACGATCCTCGTTACTTACTGGTGATGAAGGGTGCTCCAGAACGCATTCTAGAGCGCTGCTCCACGATTTTGATCAGCGGCAAGGAAGAGGTTTTGGATGATGAAATGAAAGAAGCATTTGAGAGGGCTTACCTGGAACTGGGTGGTATAGGAGAGCGTGTGTTGGGTTTCTGTCACTTTTACCTCAACGTTGAAGAATATCCTCCTGGTTTTGAGTTTGTTGCTGATGATGTGGGTGGGGTTGAGGACATTGGCATACTGAATGACAAAATGTTAAAGTTTATTTGTCTTCTTTTCAAAGCCTCCCAATTTCCCTCTTCAAACTTGTGCTTTGTTGGTTTGATGTCCATGATTGATCCTCCTCGTGCCGCTGTTCCTGATGCTGTCTGCAAATGCCGCAGTGCAGGAATCAAAGTTATCATGGTTACTGGTGATCACCCCATCACAGCCAAAGCCATCGCAAGAGGCGTGGGAATCATCTCTGAAGAAACGGAGACTGTGGAGGACATTGCAGAGAGGCTAGGTTGCCCAGTGGCTGATGTGAATCCTCGTGATGCCAAAGGCATTGTAATACACGGAGGACAACTCAAGGATCTCCCAAGGGAAAAGCTAGATGAAATCCTAATCCACCACACAGAGATTGTATTTGCCCGTACCTCTCCACAACAGAAGTTGATCATCGTAGAAGGCTGCCAGCGACAGGGCGCCATTGTTGCTGTGACTGGGGATGGTGTCAATGACTCACCTGCTTTGAAGAAAGCTGACATAGGTGTTGCTATGGGTATTGCTGGCTCAGATGTGTCCAAACAGGCAGCTGATATGATTCTGTTGGATGACAACTTTGCTTCCATTGTGACTGGTGTTGAAGAAGGTCGTTTGATCTTTGACAACTTGAAGAAGTCCATCGCATACACGCTGACCAGTAACATCCCTGAGATCACACCATTCTTGATGTTCATCATTTTTGGCATTCCTCAGCCTCTCGGTGTTGTAACCATCCTTTGTATTGACTTGGGGACTGATATGGTTCCTGCCATTTCCTTGGCCTATGAGAAAGCAGAGAGTGACATCATGAAGAGGAGACCTCGCGATCCCTTACATGACAAACTTGTGAATGAAAGATTGATTTCCATGACTTATGGACAAATTGGTTTCATACAGGCATTGGGAGGCTTCTTTACCTACTTTGTAATCATGGCAGAGAATGGCTTCCTTCCTACTCGTCTGTTTGGCATTCGAGCGGAATGGGAAGACAAGGGTAATAATAGTGTCCAGGACAGCTACGGACAGGAATGGACATACAGTCAACGGAAGGTTCTTGAGTACACATGTCACACTGCGTTCTTTGTCAGTATCGTTGTAGTGCAGTGGGCTGATTTGATCATCAGTAAGACTCGCAAGAATTCCATCATCCACCAGAAAATGACGAACAACGTCCTGAACATTGCTTTGGTGTTTGAGACTCTATTTGGCCGTGTTGCTCTGTTACACGCCTGGTTTGTCCACTGGTCTGCGGATGTACCCATTGCTGGCTGCTTGGTGGTTCCCAGCCATTCCGTTCAGCATACTGATCTTTGTGTACGACGAGTGTCGCAGATACATTATCCGAAAACATCCGGGCTGTTGGCTGGAACAAGAGACCTACTATTGATCAATTATCGCGAGTGTAATGCTACGCTTCGCTTATGGAGTGAACTCACGCTGCTGTAA

Transcript

OS493_023390-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P18907	Sodium/potassium-transporting ATPase subunit alpha-1 OS=Equus caballus OX=9796 GN=ATP1A1 PE=3 SV=1
P13607	Sodium/potassium-transporting ATPase subunit alpha OS=Drosophila melanogaster OX=7227 GN=Atpalpha PE=1 SV=3
P05023	Sodium/potassium-transporting ATPase subunit alpha-1 OS=Homo sapiens OX=9606 GN=ATP1A1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001577 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00690 all species →	Cation_ATPase_N	Cation transporter/ATPase, N-terminus	Domain	Interproscan
PF13246 all species →	Cation_ATPase	Cation transport ATPase (P-type)	Family	Interproscan
PF00122 all species →	E1-E2_ATPase	E1-E2 ATPase	Family	Interproscan
PF00689 all species →	Cation_ATPase_C	Cation transporting ATPase, C-terminus	Family	Interproscan
PF00702 all species →	Hydrolase	haloacid dehalogenase-like hydrolase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004014 all species →	Domain	Cation-transporting P-type ATPase, N-terminal	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR005775 all species →	Family	P-type ATPase subfamily IIC, subunit alpha	Interproscan
IPR008250 all species →	Homologous_superfamily	P-type ATPase, A domain superfamily	Interproscan
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan
IPR006068 all species →	Domain	Cation-transporting P-type ATPase, C-terminal	Interproscan
IPR001757 all species →	Family	P-type ATPase	Interproscan
IPR050510 all species →	Family	Cation transport ATPase (P-type)	Interproscan
IPR044492 all species →	Domain	P-type ATPase, haloacid dehalogenase domain	Interproscan
IPR018303 all species →	PTM	P-type ATPase, phosphorylation site	Interproscan
IPR023299 all species →	Homologous_superfamily	P-type ATPase, cytoplasmic domain N	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43294 all species →	SODIUM/POTASSIUM-TRANSPORTING ATPASE SUBUNIT ALPHA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006813 all species →	Biological Process	potassium ion transport	Interproscan
GO:0008556 all species →	Molecular Function	P-type potassium transmembrane transporter activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005391 all species →	Molecular Function	P-type sodium:potassium-exchanging transporter activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006883 all species →	Biological Process	intracellular sodium ion homeostasis	Interproscan
GO:0019829 all species →	Molecular Function	ATPase-coupled monoatomic cation transmembrane transporter activity	Interproscan
GO:0030007 all species →	Biological Process	intracellular potassium ion homeostasis	Interproscan
GO:0036376 all species →	Biological Process	sodium ion export across plasma membrane	Interproscan
GO:1902600 all species →	Biological Process	proton transmembrane transport	Interproscan
GO:1990573 all species →	Biological Process	potassium ion import across plasma membrane	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01539	ATP1A; sodium/potassium-transporting ATPase subunit alpha	EC:7.2.2.13	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023390-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

275.4Max TPM

101.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	112.53	159.51
polyp at pH7 6	18	18	123.74	171.41
coral polyp · control treatment	16	16	107.90	268.07
coral polyp · oil and dispersant treatment	16	16	104.72	275.42
coral polyp · oil treatment	16	16	96.83	154.38
coral polyp · dispersant treatment	16	16	70.08	143.76
Polyp	10	10	83.09	138.17

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	159.51
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	158.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	139.57
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	135.30
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	125.92
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	118.47
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	115.63
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	115.39
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	113.28
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	109.34
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.59
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	102.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	92.02
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	90.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	89.28
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.79
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.19
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	171.41
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	168.87
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	162.96
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	160.88
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	139.40
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	135.52
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	133.14
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	132.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	129.04
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	120.62
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	118.82
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	116.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	110.94
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	107.95
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	97.31
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	95.16
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	65.62
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	268.07
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	146.89
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	136.19
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	119.89
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	114.23
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	106.95
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	102.39
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	97.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	92.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.25
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.91
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	83.84
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	81.56
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.06
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.69
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.75
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	275.42
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	132.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	121.77
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	118.18
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	117.73
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	108.27
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	92.91
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	91.27
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	90.76
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.51
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	84.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.99
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.43
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.08
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.15
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	154.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	133.70
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	131.33
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	122.74
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	111.71
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	110.51
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	107.53
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	100.42
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	99.90
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	89.21
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	83.67
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	81.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.44
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.78
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	143.76
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	115.44
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	111.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	97.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	92.95
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	73.09
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.50
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.45
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.24
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.73
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.73
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.43
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.32
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.17
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.69
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	138.17
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	111.79
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	100.14
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	91.28
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	88.14
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	76.55
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	60.28
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	59.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	58.33
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	46.20

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.