Gene detail

Detailed information of OS493_023393-T1 in Lophelia pertusa

Genomic Location: scaffold_103:940309...961478
NR annotation: KAJ7390681.1, Tektin 3 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023393-T1

ATGACTCAATCTTTCGTGGAAACAGCGAAGTTTTTGTCGTCTTCGACCTTCGATCCTCCGCCATATCTACGGCCGCCCGGCGGACCTTATGAAACAACATATACGGCTTCGTTTCAAACAGGCAGACCATATACTTCCCCGCATTATTCTCTGAGGCCACTGTCGAGGTCTTTTGAATTTCCGTCTAAGATTCTAAACGGATCATCCACCGGCTTAGAACACTTGCCGTACACAGCGGTGACACAGCGCTCGATTCACAAGTATTCGCCTCAGCAATGGCGAACTTCGAACGTTCTCAATGTTTGTTCTGGGGAGAAGGAACGCGCGACTGCGGAGAGACTTCGAGATGAATGCTCGCGGCTCCGAACAGAGACGGCTTTGCTCACGCATCGAACGCAGACAGATGTCAACAAGAAGCTAGAACATCGCATTCACGATATCACCTACTGGAAGACGGAGCTGGAGAAGCAACACTCGGAAACTGTGGCCGAGATCAAAGCTTTGCAAGCGTTCATCGGCCGCTTGGAGAAAGCTTTAGCGGCGACGGAAAGGCCTTTGAACGTCTCTAAGCAATGCCTGGATTACAGAGAGAGGAGAGTCAAGATCGACCTGGTACACGACAATGTGGAGGCGCATATAAGCAAGGAAGTGGAAATGATCGAGAACGTAAGAGCTTTACTCAAGAAAACAATGGATCAAGCTCATGAGCAATTGTGGTTGCTGCGCTCTGCCAAAACTCTGCTGGAGAAGGACCTTGGTGACAAGTATGGGTCTCTTGGTATTGATGGAAAATGCTCCACAATGAACAACTTCTCTAAGGACATTCATTTTGCGCCCCACTCGGTCACAATCCAGCAACACTCCTTCACTCCGGATGAATGGGAAGCCTACTCCTCAGAAAACATTGCCAAGGCTGAGCGGGAACGCAAGGCGTCCGTGGCTCTACGATCCGAGATCAATGGTATCCTGATGCAGACCTATGTTGATCTGAGGAACATCTTTGAGACCGTGAACAATGAGTTCAGCAAGCGCATTGAAGAGACCCTCACTGCTAAGAGATCACTTGAGAAGGAACTGGCCAGGGTTATGGACGAGATAGCGTCGATGGAAAACAACGTGCGCGATCTAAGACAAGCCATCTCTGACAAGGAAAACCCCCTTAAAGTTGCTCACACCCGCTTGGACAAGCGCTCTCTGAGACCCAATGTTGAGCTGTGTCGCGACCCGGTGCAGTACCGTCTCGTCGGAGAAGTCGGAGAAATCAACGTCTCTATTGATCGCCTGCGCATGCGTCTGGCCGAGGCCGAGGCTTCCTTAATGGCGTTGCTTAGGAACAAGGAGCGACTGGAGGACGACATTGAAGTGAAGACAAACAGTCTGTTTATTGATCGTGACCAGTGTATGGTTATCAGGCAGCAGAAAGCTAAGAACCGCGGTAAATTGTTTTCCACTGGTTTCTGGAGTGAGCTTATATCGCGAGAATCAATGGCCGAGAACAAGGAATTGTTGGGTGGACTGTACGTCCAGGAGCAGTATGATGTAGACGGGACGCCAGATTCGTTTGGAAGAAGTCAGAGCTACCGTGTCGCTACGACACCATTAGTTGACAACGGGGCGAATGGCAAAGATGGCGACAAGCCGGCCAAGAAGCTTTCTAAGTCGAAAGCCAAGAAGAGGGAAAAGAAGGAAAATCTTGAAGACCTGAAGAAGGAATTAGAAATTGATTGGCATACGATCACTCTAGATGAGGTTTGCAGCCGTTTGGAAACGAACACTGAAACGGGTCTAACTAAAGAACAAGCTGCAGAAAATCTCAAGCGGGACGGTCCGAATTCCTTGACCCCTCCTCCTACCACCCCTGAGTGGGTGAAGTTCTGTCGACAGTTGTTTGGTGGCTTTGCGATGTTGTTGTGGGTTGGCGCCATTCTCTGTTTTATAGCCTTTGGCATTCTCGTAGCCACCGAGGAGGAACCATCAAAGGACAATTTGTATCTTGGGATTGTGTTTGACTGCTGTTGTGATTGTGACAGGAATCTTCTCATATTATCAAGAAGCCAAGAGTTCTCGAATCATGGAGGGCTTCAAAAATTTGGTTCCTCAAGAGGCACATGTTATGCGTGGTGGTGA

Transcript

OS493_023393-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9TTW3	Tektin-1 OS=Canis lupus familiaris OX=9615 GN=TEKT1 PE=2 SV=1
Q969V4	Tektin-1 OS=Homo sapiens OX=9606 GN=TEKT1 PE=1 SV=1
Q9DAJ2	Tektin-1 OS=Mus musculus OX=10090 GN=Tekt1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001532 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00690 all species →	Cation_ATPase_N	Cation transporter/ATPase, N-terminus	Domain	Interproscan
PF03148 all species →	Tektin	Tektin family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004014 all species →	Domain	Cation-transporting P-type ATPase, N-terminal	Interproscan
IPR000435 all species →	Family	Tektins	Interproscan
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan
IPR048256 all species →	Family	Tektin-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19960 all species →	TEKTIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0060294 all species →	Biological Process	cilium movement involved in cell motility	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0015630 all species →	Cellular Component	microtubule cytoskeleton	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08486	STX1B_2_3; syntaxin 1B/2/3	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023393-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

100.8Max TPM

24.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.36	27.64
polyp at pH7 6	18	18	15.92	23.44
coral polyp · control treatment	16	16	36.80	100.81
coral polyp · oil and dispersant treatment	16	16	28.65	48.82
coral polyp · oil treatment	16	16	24.47	50.49
coral polyp · dispersant treatment	16	16	33.01	72.00
Polyp	10	10	11.63	17.19

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.64
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.24
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.62
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.94
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.05
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.86
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.42
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.46
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.92
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.87
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.81
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.63
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.59
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.24
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.47
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.44
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.61
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.46
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.31
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.35
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.16
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.61
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.36
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.39
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.05
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.95
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.31
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.15
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.04
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.65
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.51
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.76
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.44
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	100.81
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.51
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.56
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.45
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.06
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.92
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.67
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.18
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.40
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.66
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.28
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.66
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.44
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.83
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.82
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.01
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.81
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.56
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.21
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.95
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.46
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.76
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.94
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.02
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.92
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.81
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.17
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.11
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.97
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.49
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.16
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.46
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.96
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.95
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.54
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.23
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.01
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.82
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.58
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.50
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.93
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.70
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.43
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	72.00
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.14
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.98
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.58
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.66
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.53
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.32
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.06
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.93
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.92
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.99
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.21
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.45
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.14
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.19
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	15.84
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.29
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.21
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.74
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.09
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.38
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.62
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.43

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.