Gene detail

Detailed information of OS493_023425-T1 in Lophelia pertusa

Genomic Location: scaffold_104:119496...133113
NR annotation: KAJ7384101.1, hypothetical protein OS493_023425 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023425-T1

ATGGTCTCGGAAAGTTTTGATAGTTTTGTGGCGCCTGTGATTAATAAACCTGTGCCTAATCACCTCTTGGAAACAAAAATCTATGCCAAAGTTGGACAGAACTCTATTTTGCAGGCCAAACCTTCGGTGATTCACTTTACTGGATTTCAAGTCGGCGAAAAAATTACCCGAACCCTTAGATTAGCAAATGCTTCTGATGAAAGCCAAAGAATGCACATCCTTCCTCCATCTACTAAGTACTTTTACATCAAATACACAAAGAAGGAGAAGCTTGTGCCTGGAATGTTTGTTGAAGTTGTTGTTGAGTTTATGCCTGATGAATGGAGATATTATTATGACTGTATTCGAATTCACACCAAGGCGGAGGAAAACCTCATAATTCCTATCCATGCATATCCTGTGATGAACACAGATGGATTTCCCAGGGAGGTTCACTTTCCTTCTGTTCCACTGGGAGAGGAAATAACACAAATGATTCCTCTCAAGTGTGGTATCCCTGTGGATTTTGAGTTCACATTGAGTTATGTTCAGTTGCACCCAGCGTTCACAGTGGAACCAATGTCAGGAATTGTGCCAGGTAATAGTGAAGTGCAGGTTAAAGTGACATTTGCACCAATGGACTTCTCAACTGCTCACATGAAACTTCAGCTTGTGGTCTCCCAGTTCAATATGTCTCCACTTGTCTGCTCATTTACTGGCACTTCAGAGCCAGGACTTACTAAAAGATTAATAGAACAAGCATGGACAGCAGAATTACCCCCTGTACCTCCAAGTGGGATCCTAGACCCAGTGTTGATTGATCCTCTCGGCAGAACAAGGCTGAAGAAACTCAAGACCAGACCTTGGACTCCAGGAGACAGAAAACCACAGGAACTTGTTAGAGATGGATTGAGATTTCCAGTTATTGGTCTTGATAATCCATTTACAGTATCAAGTGTTCTTTTGCAACAACCTGGAAAATTAAAGGCGAAGCAGATCAGGGAAGCTGTTCAAACTAAAAAAGATGTGACTGGAAGCACAAAACAAATGAAAGAAACTAAGTTTGAATATGAAGTCCATCAGAACATTCAAGAAGAAAGACAGAACCAACTCAGATGGTGTGTAAGATTAGGTGAGAATCCAATCTTGGACGTTGCAAAGAAACAGATCAGTGAAACAAGAACAGTCAGTGAAAGAGAATACAAGCTAAAGCGCGGTGACCCAGTAACAGAAGTGGAGTTTGACCGGTCTTGTGTTGGGTGTGAGTTGAGAAGAATTCACAGACAAGCGGATGAAGTTCCGCAGCATGATCCCAGATTCGATCTTCTTGTTAATGACGAGTGGAGCAAACGACACATGGTGGTACAGAAGTTTGTTCAAGCAGGACGAAAGGTTATAGTGAGGCTAAGAGCCAATAAACACTTGAGTTCACTGGGAGAGTTTGTCACTGACTGGAGAAAAGGAAAATTCACCAGGGAACATACGAGAAGTCAACTTGCGGAGAGTGAGGAGGAGAAGCTATTCGATGAAGCTGAAGTTGCTTTGCTGATCAAGTCTGAAGGCATTTTTCCGTTTTGTTTTCCTTCGTACAAGTCTCCTGATACAAAAGATGACATGGATGTCGACGCCCTTGGTACATTAAATGTTCAAGCAACAGTTGTTAATGTCAAAACGCACGTTCCTTATTATAACCTGAAGGTCCCTAAACAATATGGAATATTCGGTTATAATCCTCACTCAGTGGCTGATGCATCCTCAGGATATGTCCCGCCAAAGCTGGTCCGTCCCTTGAGAGTCGGCGCTGAGGACGAGATCATCAACTTGGTCAGCAGCATACCTCTGACGTCGATAAGAAGCCCCAGTCATGCTCCGACCACAGAAGGCGGCGAGGAAACTAAGGAAGAGGCTGATGGAGACAGAGTACATAGTCCACAGATGAAAAGCCCCATAATTGCAACCCCGCAAGAGGACATGGCTGTGCAGGAGCCTGAGGCCGTGCCCCTTGTGGTGCCTGCCTCGCTGTTTAGGCCCACTTCTTACCACTCCATGCATATTTTTGTAAGTCACGTAACACGCTTGTTAACAGGCTAG

Transcript

OS493_023425-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4G0U5	Cilia- and flagella-associated protein 221 OS=Homo sapiens OX=9606 GN=CFAP221 PE=1 SV=2
A9Q751	Cilia- and flagella-associated protein 221 OS=Mus musculus OX=10090 GN=Cfap221 PE=1 SV=1
A8J6X7	Cilia- and flagella-associated protein 221 homolog OS=Chlamydomonas reinhardtii OX=3055 GN=CFAP221 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004265 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_023425-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR029676 all species →	Family	Cilia- and flagella-associated protein 221	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46500 all species →	CILIA- AND FLAGELLA-ASSOCIATED PROTEIN 221	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003341 all species →	Biological Process	cilium movement	Interproscan
GO:0005929 all species →	Cellular Component	cilium	Interproscan
GO:0044458 all species →	Biological Process	motile cilium assembly	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0097729 all species →	Cellular Component	9+2 motile cilium	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25610	CFAP221, PCDP1; cilia- and flagella-associated protein 221	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023425-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

19.0Max TPM

4.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.67	6.92
polyp at pH7 6	18	18	4.37	8.77
coral polyp · control treatment	16	16	5.58	18.98
coral polyp · oil and dispersant treatment	16	16	4.35	16.80
coral polyp · oil treatment	16	16	4.54	7.17
coral polyp · dispersant treatment	16	16	3.63	9.35
Polyp	10	10	3.91	6.13

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.92
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.62
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.26
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.94
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.72
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.63
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.06
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.89
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.45
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.28
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.21
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.91
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.67
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.43
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.15
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.10
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.59
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.77
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.16
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.49
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.89
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.73
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.34
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.26
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.02
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.96
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.91
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.53
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.23
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.07
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.05
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.03
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.98
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.04
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.92
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.24
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.63
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.09
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.95
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.65
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.22
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.21
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.66
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.53
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.80
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.10
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.66
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.43
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.74
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.65
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.64
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.55
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.29
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.99
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.70
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.30
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.18
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.92
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.17
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.83
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.47
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.35
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.93
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.28
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.65
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.52
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.98
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.97
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.67
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.67
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.90
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.35
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.72
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.51
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.72
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.58
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.20
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.18
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.16
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.14
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.55
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.43
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.75
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.13
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.65
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.09
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.74
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.87
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.78
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.89
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.49
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.98

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.