Gene detail

Detailed information of OS493_023430-T1 in Lophelia pertusa

Genomic Location: scaffold_104:180071...197864
NR annotation: KAJ7384106.1, hypothetical protein OS493_023430 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023430-T1

ATGGTTTCGGAAAGTTTTGATAGTTTTGTGGCGCCTGTGATTAATAAACCTGTGCCTAATCACCTCTTGGAAACAAAAATCTATGCCAAAGTTGGACAGAACTCTATTTTGCAGGCCAAACCTTCGGTGATTCACTTTACTGGATTTCAAGTTGGCGAAAAAATTACCCGAACCCTTAGATTAGCAAATGCTTCTGATGAAAGCCAAAGAATGCACATCCTTCCTCCATCTACTAAGTACTTTTACATCAAATACACAAAGAAGGAGAAGCTTGTGCCTGGAATGTTTGTTGAAGTTGTTGTTGAGTTTATGCCTGATGAATGGAGATATTATTATGACTGTATTCGAATTCACACCAAGGCGGAGGAAAACCTCATAATTCCTATCCATGCATATCCTGTGATGAACACAGATGGATTTCCCAGGGAGGTTCACTTTCCTTCTGTTCCACTGGGAGAGGAAATAACACAAATGATTCCTCTCAAGTGTGGTATCCCTGTGGATTTTGAGTTCACATTGAGTTATGTTCAGTTGCACCCAGCATTCACAGTGGAACCAATGTCAGGAATTGTGCCAGGTAACAGTGAAGTGCAGGTTAAAGTGACATTTGCACCAATGGACTTCTCAACTGCTCACATGAAACTTCAGCTTGTGGTCTCCCAGTTCAATATGTCTCCACTTGTCTGCTCATTTACTGGAACTTCAGAGCCAGGACTTACAAAAAGATTAATAGAACAAGCATGGACAGCAGAATTACCCCCTGTACCTCCAAGTGGGATCCTAGACCCAGTGTTGATTGATCCTCTCGGCAGAACGAGGCTGAAGAAACTCAAGACCAGACCTTGGACTCCAGGAGACAGAAAACCACAGGAACTTGTCAAAGATGGATTGAGATTTCCAGTTATTGGTCTTGATAATCCATTTACAGTGTCAAGTGTTCTTTTGCAACAACCTGGAAAATTAAAGGCAAAGCAGATCAGGGAAGCTGTTCAAACTAAAAAAGATGTGACTGGAAGCACAAAACAAATGAAAGAAACTAAGTTTGAATATGAAGTCCATCAGAACATTCAAGAAGAAAGACAGAACCAACTCAGATGGTGTGTAAGATTAGGTGAGAATCCAATCTTGGACATTGCAAAGAAACAGATCAGTGAAACAAGAACAGTCAGTGAAAGAGAATACAAGCTAAAGCGCGGTGACCCAGTAACAGAAGTGGAGTTTGACCGGTCTTGTGTTGGATGTGAGTTGAGAAGAATTCACAGACAAGCGGATGAAGTTCCTCAGCATGATCCCAGATTCGATCTTCTTGTTAATGACGAGTGGAGCAAACGACACATGGTGGTACAGAAGTTTGTTCAAGCAGGACGAAAGGTTATAGTGAGGCTAAGAGCCAATAAACACTTGAGTTCACTGGGAGAGTTTGTCACTGACTGGAGAAAAGGAAAATTCACCAGGGAACATACGAGAAGTCAACTTGCAGAGAGTGAGGAGGAGAAGTTATTCGATGAAGCTGAAGTTCCTTTGCTGATCAAGTCTGAAGGCATTTTTCCGTTTTGTTTTCCTTCGTACAAGTCTCCTGATACAAAAGATGACATGGATGTCGACGCCCTTGGTACATTAAATGTTCAAGCAACAGTTGTTAATGTCAAAACGCACGTTCCTTATTATAACCTGAAGGTCCCTAAACAGTATGGAATATTTGGTTATAATCCTCACTCAGTGGCTGATGCATCCTCGGGATATGTCCCGCCAAAGCTGGTCCGTCCCTTGAGAGTCGGCGCTGAGGACGAGATCATCAACTTGGTCAGCAGCATACCTCTGACGTCGATAAGAAGCCCCAGTCCTGCTCCGACCACAGAAGGCGGCGAGGAAACTAAGGAAGAGGCTGATGGAGACAGAGTACATAGTCCACAGATGAAAAGCCCCATAATTGCAACCCCACAAGAGGACATGGCTGTGCAGGAGCCTGAGGCCGTGCCCCTTGTGGTGCCTGCCTCGCTGTTTAGGCCCACTTCTTACCACTCCATGCATATTTTTAACCCCGCGCCTGGTTTGCAAGTGTTCAAACCTCCGCTGCCGTACGCAGAAGTGGATGAAGATTATCATTTGTGTCCTCTTCCACGAAACAGAACATCAGGGAAGTCAGGGAAACAGGGCAGAAAATATCTGGAGAGACAGGATGTTATTCCCGGTGTAATGACGTGGAAGCGGTTTCCATGCCAACCTCTCGTTTCCATGGCAGCAAATCCAACGATATCAAATGTTTGGATTCCTCGATGGACTGATCCATTCAGTAAGGATTTGCTACCTACAGACGTGCCTTCACTGTTACATGGCCTCCCTGAGGAGGATGTCATGAGCGATGATGAAATGGACGAGGAAGGAGCAGACCCTGGGTTCAAGGAGATCCCAGTTCCCACTCCAGAGATGGTTCGTGCCCAGTTCCCCACGGCAGAAAGCGTACTTGGAGACCAAGACCAACAAGTGACGTCACAGCTGAGTGAAATGATGCTACACACTGGTGGAAACACGAAGATGTCAGCGGCTACCTCAGCGGCAGCAAACCGCATCCTTCGTTCCAAGGGAAAAACGCGAGAAGGAGTTGAACGAATTTTTGAGGCAGCGACAGAACAGAGTTGGCACGAGGATTAA

Transcript

OS493_023430-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4G0U5	Cilia- and flagella-associated protein 221 OS=Homo sapiens OX=9606 GN=CFAP221 PE=1 SV=2
A9Q751	Cilia- and flagella-associated protein 221 OS=Mus musculus OX=10090 GN=Cfap221 PE=1 SV=1
A8J6X7	Cilia- and flagella-associated protein 221 homolog OS=Chlamydomonas reinhardtii OX=3055 GN=CFAP221 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004265 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_023430-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR029676 all species →	Family	Cilia- and flagella-associated protein 221	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46500 all species →	CILIA- AND FLAGELLA-ASSOCIATED PROTEIN 221	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003341 all species →	Biological Process	cilium movement	Interproscan
GO:0005929 all species →	Cellular Component	cilium	Interproscan
GO:0044458 all species →	Biological Process	motile cilium assembly	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0097729 all species →	Cellular Component	9+2 motile cilium	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25610	CFAP221, PCDP1; cilia- and flagella-associated protein 221	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023430-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

35.3Max TPM

5.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.22	7.67
polyp at pH7 6	18	18	4.62	8.24
coral polyp · control treatment	16	16	7.50	33.90
coral polyp · oil and dispersant treatment	16	16	6.12	35.28
coral polyp · oil treatment	16	16	5.61	9.46
coral polyp · dispersant treatment	16	16	4.23	7.82
Polyp	10	10	5.81	10.08

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.67
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.32
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.19
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.09
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.95
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.88
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.88
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.70
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.70
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.62
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.12
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.78
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.44
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.30
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.05
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.59
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.24
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.13
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.08
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.84
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.75
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.17
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.77
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.62
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.52
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.38
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.12
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.91
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.90
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.50
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.21
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.67
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.48
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.43
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.86
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.77
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.49
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.03
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.75
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.29
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.18
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.09
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.71
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.28
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.80
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.97
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.64
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.99
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.78
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.71
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.29
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.83
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.82
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.50
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.26
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.00
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.82
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.08
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.46
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.73
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.24
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.19
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.11
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.65
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.92
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.93
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.93
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.77
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.14
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.89
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.83
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.10
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.82
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.95
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.04
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.92
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.77
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.63
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.27
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.01
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.86
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.77
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.55
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.05
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.76
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.10
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.08
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.79
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.44
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.19
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.71
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.10
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.93
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.51
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.84
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.54

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.