Gene detail

Detailed information of OS493_023454-T1 in Lophelia pertusa

Genomic Location: scaffold_104:455872...471198
NR annotation: KAJ7384127.1, R3H domain-containing protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023454-T1

ATGATGGATGAGAGATTTCCTTTAGATAACAGTCCTGATATGACAAACCACCAGGAAAACTGCACTCATACTCCTGCCGAGAAATCTAAAACTCCCGTTGTCACCACTGCCGAAGTATCCAGTGACGAGAGCACAAAGGCAGAGTCCCCCAAACAGCCTCAAGCTATCACCATGGCAACACAACCCAAGGCTTCTTTAAGTACTGTTCACGTGCAGCAGAGTTTCCATGGAATCCGTACATCAATACCTGTGCTTACTCATTCAGCTTCTGAGCCCGCCTCTTACCATCATGCAAGGAAAACTCTTGTGCGAAGTGCTGCAGTGACAAGTGTGCCTTCACCCCCACCCGCACAGTACCCAGATGAGGTTACCGAGGGTACACCACCTTACAAGAATACCAGTTTTGATTCCATTGACAGTGGGATAGCGGGAGAGTTGCCACCCAGACTGGAAGCCTTGGCTAGAGCTTCTAAACAGAGTTCACTTTCTAGAGATGGCTCATTTGAATACACAGATTCCACAGGGACAGACCTCCATGATTTTATTCTAAAGACTTTAAAGAATCCCAGGGATCGAAAATTTCTTATGAGACTTGAACAGGACTTCCTCAATTTTATTCCACAACCAGCTCTCTTCCTTCATTACCCACCAATGACGTCATACCATCGCATGATTGTGCACAGAGTTGCAGCCTACTTTGGTATGGATCACAATGTTGATCAACAAACTGGAAAATCAGTGATTATAAACAAAACAATTAACACAAGAATACCTGACAGCAGATTTTTAGAATTGATACCCCGGGAAGAATCAGAGGACTCAGAGAGTGCTATTCCACGATTAATTCTTAAAAGACAAAATACACCAGATGATAGTACTCCTCCAAAGATTGATAGCCCTGTTCTTATTCATTCTATGGAGGACAAACGCTCAAAATCAATTGAAGAAAGAGAAGAGGAGTATCATAAAGCCAGGGAAAGAATATTTAATCAGGATTCAATTTCATCACAGTCTTCACAGTCTTCAAAGGGTGACGGTGATATTATGCCGCCTCAACTCCTCCAAAGGGAGGACATTGAGGATGTTGATGATGATGATGTTGCCGTAGAGGAGACACCTGAGAGACTCCCTATCAGTAAAATAGGCAAATCAAAATCTGAGGAAGTAGATGTACCAGGAGACAGGGCCACAGCAGGGACATCAGGCATCAGAATTATGACCAACAAGCCTTTCATAAGGTCCAGCAGTAGTCCTGGTGTTATCAATGTAAGCAGTCCCCCCGCCTTTGAGCGCATCTCCAATTCTACTCGCCGAGGGTCAGATGGAAGCCAGAGGATGAGCCAGCGTCATGTGCCCAGCTCACAGACTGTCATGTCAGCGCCGCTACCTTACTGGGCGGCGGAGGGTGTCCCTTTTGTTGCTCATAACCTTCCTTCCGGAGAAGTGCAAATGTTGCCTGTCCAAGCAGCGACTCCTGGAATGCAAGGGATGATGCCGGTTATGGCTGCACAAGGTGCCACATCACAGCAGACTGCAGGTGGAGTGATGTGGTCAATGCCTCAGGAGCCTGTACAGCATGGAGTGATGCTTATAAACCCAAATACAGGCACTCCTTTAGTAGGACCTGATGGAAACCCTCTGGTAATGCAACCGACCTACCAACAAGTCATGGTCAAACCAGGCTCAACACCAGGCTACACTCAACCATCTACAGCCCGCGCCACAGTGCAAGGTGCACAGCAGCCTTCCACAATAGCGCAACAGCAACAACAACAACAGCAGCAGCAGCAGCAGCAACAACAACAGCAGCAGCAACAGCAACAACAGCAGCAGTCTGCTGTGAATTCTGGCCAAATTGTCATGCCGCAGTATGTCGGTATGCCACAGCCGATGTATGTGATGCCCTCCAATGGTCGGCCGCCTTATGCACAGCAACAGGCTGGAGCGGAGTGCACGCCGGGAAGTCATTGGCCAGGCTCGGGGCAGGCGGTGACGTCAGCCAATCCGGGATACCAAGAAATGGCAGCCCAGTTTGGCGGGCTTTCTCTGTCGGGACAACAGGCCACTCTTGACTCCGCCGCGTATCATCACCAACAACAATACGCCGAGTCTGGCGTGCCTAGTTCAACTCGTACCACGTCGCCAATGTACGTGAACAGTGTCACACAAGCTGGCGTGACAGGTCAAATGCAGTACGTTGTGTTACCGCATTCTGGCCTGCAGTCTCAATTGAGGCCTATGATACAAGGCCAAGCTTATGGCGGACAAGCGGTTGCCCAGACCGCGTCCCCGCAGCAGCAATATCAAGGTTACGTTGTGTCGCCAACACAAACGCCATATCAACAATTTCCTTACGGCACCTTACCCAAAGATGTCACGTCCTCAGTAATTCAACAACACGCCCGCTCTCAAACACCACCCACCCTCCCCAGACAGCGTCGCCTGCCCTTACGAACCAGTATTTGCAGCAGCAGCAACAGCTGA

Transcript

OS493_023454-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q15032	R3H domain-containing protein 1 OS=Homo sapiens OX=9606 GN=R3HDM1 PE=1 SV=3
A0JNC2	R3H domain-containing protein 2 OS=Bos taurus OX=9913 GN=R3HDM2 PE=2 SV=1
Q9DCB4	cAMP-regulated phosphoprotein 21 OS=Mus musculus OX=10090 GN=Arpp21 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002765 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01424 all species →	R3H	R3H domain	Domain	Interproscan
PF12752 all species →	SUZ	SUZ domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001374 all species →	Domain	R3H domain	Interproscan
IPR036867 all species →	Homologous_superfamily	R3H domain superfamily	Interproscan
IPR051937 all species →	Family	R3H domain-containing	Interproscan
IPR024771 all species →	Domain	SUZ domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15672 all species →	CAMP-REGULATED PHOSPHOPROTEIN 21 RELATED R3H DOMAIN CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023454-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023454-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

106.2Max TPM

32.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	31.12	44.99
polyp at pH7 6	18	18	29.17	33.89
coral polyp · control treatment	16	16	43.91	106.25
coral polyp · oil and dispersant treatment	16	16	30.28	59.76
coral polyp · oil treatment	16	16	30.85	50.75
coral polyp · dispersant treatment	16	16	37.48	67.66
Polyp	10	10	20.51	39.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.99
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.66
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.55
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.23
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.16
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.65
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.15
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.51
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.13
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.27
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.88
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.57
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.56
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.93
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.86
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.44
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.89
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.64
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.33
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.58
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.98
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.65
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.60
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.60
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.09
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.55
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.54
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.30
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.42
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.21
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.87
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.72
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	106.25
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.63
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.37
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.30
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.26
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.34
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.45
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.12
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.51
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.83
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.14
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.98
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.42
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.05
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.59
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.26
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.76
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.74
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.54
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.76
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.12
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.78
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.92
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.96
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.75
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.36
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.05
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.23
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.23
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.75
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.16
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.49
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.48
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.20
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.75
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.87
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.28
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.88
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.24
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.03
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.57
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.57
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.61
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.83
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.66
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.13
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.42
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.76
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.72
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.48
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.10
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.66
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.96
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.19
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.98
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.84
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.20
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	39.57
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	28.57
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	26.52
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	25.96
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	16.39
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	15.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	12.26
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.09
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.27

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.