Gene detail

Detailed information of OS493_023519-T1 in Lophelia pertusa

Genomic Location: scaffold_104:1080202...1092304
NR annotation: KAJ7384190.1, Rhophilin, Rho GTPase binding protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023519-T1

ATGGCGGGTTGGATAAATCTTCCATTGAAGCGGTCCGATGGTGTTGACTATAAAAAGCCGTTGGAGAAGTTTATCAAGAACACATTTTCCGCTGAAACCGCGACTGAGAACGAAGACGCCATTTCTGAGCTAGCGAAGTTGAGAAATACTGCTGTAATGCAGACCTTGGACAAACATGAATCTGCTTTGGAGCCGTTGTTAAGGTACTATGATCAACTGGGTGCAATGGAGGGTAAACTACCAATATCAGAATCACAGATTAGAATCTCGTTTACTTGGTATGACGCATTTGACAAAGGATCCTTGTTTGGTTATCGCAAGAGCTCAATGTCAAGTCTCCAATATGAGCGGCTGTGTGTGCTTTTTAACATTGGGGTTTTACAAGGACAGATTGCTGCAGCTCAAAACTTTCAGTCAGACGAGGGATTGAAAACTGCGGCAAAAATGTTCCAGAATGCCAGCGGTGCTTTCCAACTTCTGAAAGAAACAGTGTTTCCGCAGCTGCATCAGGTACCAACACCTGACCTGTCTGTGGAGATGCTGGTAGCGCTTTCTGCTATTATGTTAGCACAAGGGCAAGAAAGCATTTGGAACAAAACAGAGCAAGATAAAATGAAGGATGCTATTATTGCAAAGGTTGCTGCACAGGCAGCGGATTATTACAAGAGTGCGTACAGTGCTTCACAAGTTACGTCCGTTAAACAAGTATTGGAGAAGGAGTGGATTACGATTTTGTTGGCCAAATCTGAATTCTTCAAAGCGATAGCTGAGTATCATCAGGCTAGAGTAGCCCAGGAGAAAGGAGCTTATGGCGAGGGTGTGACCAGGTTTAAGCAAGCTGAGCAGTTGATGGGCAATGCTGTAAAACAGAGCCTGGGACTAGTCGACTGCAAGACGTGGCAGGGCAGGATTCAGCGTGAGGCAGCTGCGCTAAAAAAAGACAACGAGTTTATTTATCACGAAAGAACACCTGATATAGATTCCTTGACGGTTATTGGCCGTGCAGCTCTCGCCAAGTCCTTACCACCATCCAAACCGGCTTCAACCCGTTTTGTAGACCTGTTTACCAAGTTGGTGCCCATGGCGGTCCATAATGCTTTGCAGGCGTACGAATCTCGCAAAGGAGAAATAATCAACTTTGAAGTTGGCCGACTACGTGAAGGAACCCAGTTAATGAACAGTGTTCTTGCGTCGTTGAATTTGCCGGCGGCCATAGAAGACTTATCGGGACAGACGATTCCCAAGTCAGTGTTGGACAAATCTGCGGCGGTGAACGAGAAAGGAGGTTTAAATGCCATCGACACGTTCATGCAGGACTTGCCAGAACTTCTGCAAAGAAATCGAGAAATTCTGGACGAGGCAACACGGATGATGGACGAGGAAGAACGCCAGGACACGCAGATGAGAGATCGCTTCAAAGCCAAATGGACGCCAAAACCATCAGCTGAACTCACTGCACAGCTCAGACAAGAAGCTGATAAATATCGCACCATCATGGAGAACGCCGTGCGAGCTGACGCTGTTGTGCGAGAGAAATACAACAAACATCGACGAAACATGGATCTACTGAGCAAAGGGGAGGCGGAGTTGACAGCAGCCATACCTAAAGTTGGAGCTGCGTCATCATCATCATCTTCCAGTCCTGCTGTTCAGGAACTGAGAAAACTGATGGAACAAGTGGATACCATCAAAGCTGAAAGAGACGGCATGGAACAGGACTTGAAAGTACAACAAGACGATATGGCCGTGAAGTTTCTCAGCGCCCTTGCCGCCGATGGTACTATCCCGGATGTAGAGGGGATTATCAGTTCTAATCTGGGCGCGGGATTTGATTCGCTGAAGGAAAGTGTCACTGACAGTATTGCGAGTCAAGAGAAGATTCTCGCTTCAGTTCAGGCTGCTAATGATAAATTTGTCAGAGAAAAACAGTCCGGACAGGCAGCAACCGAACGAGAAACCATGCTGAAAGATCTAGCGACAGCTTATGATATTTACATGGAGCTGATTGGCAATCTGCAGGAAGGAACTAAGTTCTACAATGATTTCACCCCGATATTGGTGCGTTACCAACAAAAAGCCAGCGATCTCGTTTTCGCTCGAAAAACGGAGCGCGAGGAGTTGTCCAGAGATCTCCAGAAGACGATAGCCAACCAGCCGGCAGAACCAACTCCTCAAGCGCCGCCACACCATCAACCCACAGGTGCACGAGCTCCTCCTAGTCGCCCTCCACCTCCGTCTGCCAGCACAGCAGCAGCAGCAGCAGCAGCAACCACCGATGCCCCATGCAACCTCGGCACCTCCGCCACGCCCGGGTGCTCCAGGCGCACCTCCGATGGCTCCACCATCCGGGGCTCCCCCACAGTACCCCGCTCAACAGTACCAACCTATGCCTCCCCCTGGATACATGCCTTATCAGTACGGGAGTTATGCACCTCCAGGAGGGGTCGGTGGGGTGCCCGGGGGTACCCTGGGTATGCACCCCAGCTACCCGCCGGTTATTACTATGGTGGATATGGAGTGCCTCAACCTCAAGGCTACCCCCCTCAGGGACAACAACCTCCACCTGGGGGGTACCCACCTCGCTAG

Transcript

OS493_023519-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8WUM4	Programmed cell death 6-interacting protein OS=Homo sapiens OX=9606 GN=PDCD6IP PE=1 SV=1
Q9WU78	Programmed cell death 6-interacting protein OS=Mus musculus OX=10090 GN=Pdcd6ip PE=1 SV=3
Q9QZA2	Programmed cell death 6-interacting protein OS=Rattus norvegicus OX=10116 GN=Pdcd6ip PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004844 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03097 all species →	BRO1	BRO1-like domain	Repeat	Interproscan
PF13949 all species →	ALIX_LYPXL_bnd	ALIX V-shaped domain binding to HIV	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004328 all species →	Domain	BRO1 domain	Interproscan
IPR038499 all species →	Homologous_superfamily	BRO1 domain superfamily	Interproscan
IPR045251 all species →	Family	Vacuolar protein-sorting protein Bro1-like	Interproscan
IPR025304 all species →	Domain	ALIX V-shaped domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23030 all species →	PCD6 INTERACTING PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000281 all species →	Biological Process	mitotic cytokinesis	Interproscan
GO:0005768 all species →	Cellular Component	endosome	Interproscan
GO:0071985 all species →	Biological Process	multivesicular body sorting pathway	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12200	PDCD6IP, ALIX, RIM20; programmed cell death 6-interacting protein	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023519-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

113.5Max TPM

49.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	31.37	45.27
polyp at pH7 6	18	18	31.80	41.76
coral polyp · control treatment	16	16	62.63	94.21
coral polyp · oil and dispersant treatment	16	16	77.35	100.51
coral polyp · oil treatment	16	16	50.37	75.15
coral polyp · dispersant treatment	16	16	69.35	113.47
Polyp	10	10	16.41	25.30

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.27
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.94
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.48
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.65
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.45
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.85
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.73
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.35
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.34
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.68
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.46
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.36
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.19
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.00
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.66
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.87
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.43
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.76
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.40
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.30
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.15
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.96
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.05
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.24
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.64
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.58
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.32
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.92
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.97
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.02
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.23
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.41
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.39
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	94.21
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	93.16
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	93.05
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	82.95
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.98
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.52
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.81
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.71
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.34
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.78
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.00
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.01
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.40
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.01
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.64
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.47
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	100.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	94.47
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.98
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.73
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	91.93
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.50
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.48
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.28
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.10
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.78
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.22
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.41
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.88
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.15
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.05
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	75.15
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	69.75
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.01
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.59
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.49
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.50
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.92
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.82
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.91
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.62
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.03
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.42
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.31
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.76
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.77
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	113.47
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	98.07
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	86.42
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.77
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.07
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	82.81
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	81.36
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	79.04
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	71.57
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	71.33
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.36
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.55
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.46
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.06
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.79
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.52
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	25.30
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	24.40
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	24.21
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.22
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.42
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.13
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.08
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.39

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.