Gene detail

Detailed information of OS493_023525-T1 in Lophelia pertusa

Genomic Location: scaffold_104:1152488...1175328
NR annotation: KAJ7384196.1, hypothetical protein OS493_023525 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023525-T1

ATGTCTTCCCTCTTCAGATCAGAGGAGATGACACTGGCCCAACTTTTTCTTCAAGCTGAGGCAGCTTATTCCTGTGTCAGCGAACTTGGAGAGTTGGGCCTTGTGCAATTCCGAGATTTGAATCCCGATGTTAATGCTTTTCAACGCAAATTTGTAAATGAAGTCAGGCGATGCGAGGAGATGGAAAGAAAACTTAGATTTCTTAACAAGGAAATTGAAAAGGCTGATATTCATATTACGGACACCGGAGAAAATCCAGAAGCTCCCCAACCACGAGAAATGATTGACCTTGAGGCCCAGTTTGAGCAGCTTGAGAATGAAATGAAGGACAGCAATGCAAATTATGAAGCACTCATGAAGAGCTTCCTGGAGCTGACAGAACTCAAACACATTCTACGCAAGACACAGGCCTTCTTTGAAGAGGCCGAACTACATGTGCATAATCAACAACAGATCCATGAACCACAGGGTACTGATGATATGCAAGCGCTCTTAGGAGATGAACCAAAAGGAGGGGCCACAGCAACGGCAACCCAACTGGGATTTGTGACTGGAGTAATAGCTCGTGAACGAGTGCCTTCATTTGAGCGACTTCTGTGGCGTGCCTGCCGTGGTAATGTTTTCTTCAAACAGGCTGAAATTGAGACTCCGCTTGAAGACCCAAGCACCGGTGACCAGGTCTATAAGTGCGTCTTCATTATCTTCTTTCAAGGAGATCAGCTCAAGAGCAGGGTGAAGAAGATTTGTGAGGGGTTTCGAGCTACACTCTACCCCTGTCCTGATACTGCGGCAGAAAGGCGGGAAATGGCCATTGGAGTAAACACAAGGATTGAAGATCTTCAAACAGTATTGAATGAAACACGTGACCATCGTCATCGCCTGCTGGTGACTGTAGCGAAGAACATTAACCAGTGGTTCATTAAGGTCAAGAAGATCAAGGCCATCTATCACACCATGAACATGTTCAACCTGGATGTGACTCAGAAGTGTCTCATTGCCGAGTGCTGGTGCCCGGTTAGTGACTTGGACAAGATTCAGCAAGCCCTGCGGCGTGGCACAGAGAGCAGTGGGGCTGCTATACCATCTATTCTGAATCGCATGGCCAGTCGTCAAGAGCCGCCAACTTTTAACAGGACTAACAAGTTTACGCAGGGGTTTCAAGCCATTGTAGATGCCTATGGAGTAGCTAACTACCAGGAGGTTAATCCAGCGTTGTTTACCATCATCACATTTCCGTTCCTGTTTGCGGTCATGTTTGGAGACTGTGGACATGGTTTGATCATGTTCCTTTTTGCTCTGTGGTTGGTGATGAATGAGAAGAAACTGGCTTTATACAAAGAAGGAGGAGAGATGTTTGAGACCATGTTTGATGGCCGCTATATAATTATGTTGATGGGATTGTTTGCAATCTACACTGGCTTCATATACAATGACTGCTTTTCAAAGTCGTTCAACATCTTTGGTACCGCATGGGACCTTAATGTTGATTGGGGTTCGATCACTAAAAAGGCACTGGATTCCTATGATGAAACAAAAGAAATCATGGTCGACCCAAAGCAGACATACCGAGGGGTACCTTACTTCTTTGGTATCGATCCAATCTGGCAAGTGGCTGTGAACAAACTCACATTCACCAATTCATTTAAAATGAAGCTGTCTGTTGTGTTTGGTGTGACGCACATGATGTTTGGTGTTTGCCTGAGTTTCTTTAATCACAGGCACTTCAAGAAGCCTCTGAATATTATTGCAGAGTTTATACCTCAGGTTCTATTTTTGTTCTGCATCTTTGGCTACCTGGTTATTTTGATCTTCTTCAAATGGATCTTTATCAATTGCAATTCACCAAATCAAGCAAGTTTGCTGTTGGCACTCATCAACATGTTTCTTCAATTTGGATCAAAGATTGAGGGCGCTGACTTGCTATTTGCTGGACAGTCGTTTGTACAGCCATTACTGGTAGTAATTGCAGTGTTGTGTGTGCCGTGGATGCTCCTAATGAAACCACTCTATCTCCGACATCAACACAAGGCAACTGAAGCTCAAGGTTTTCAGAGGCTGAGATCAAGCACCCCAGCCCTCCCCCGGTATCAGTGCAGATTGGAGAGAATGGACAGGACCCTGGTGAAGTGGTGCATCATGAAGGCCAAGCACAGGTAG

Transcript

OS493_023525-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z1G4	V-type proton ATPase 116 kDa subunit a 1 OS=Mus musculus OX=10090 GN=Atp6v0a1 PE=1 SV=3
Q29466	V-type proton ATPase 116 kDa subunit a 1 OS=Bos taurus OX=9913 GN=ATP6V0A1 PE=1 SV=1
Q93050	V-type proton ATPase 116 kDa subunit a 1 OS=Homo sapiens OX=9606 GN=ATP6V0A1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001726 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01496 all species →	V_ATPase_I	V-type ATPase 116kDa subunit family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002490 all species →	Family	V-type ATPase, V0 complex, 116kDa subunit family	Interproscan
IPR026028 all species →	Family	ATPase, V0 complex, subunit 116kDa, eukaryotic	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11629 all species →	VACUOLAR PROTON ATPASES	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007035 all species →	Biological Process	vacuolar acidification	Interproscan
GO:0016471 all species →	Cellular Component	vacuolar proton-transporting V-type ATPase complex	Interproscan
GO:0033179 all species →	Cellular Component	proton-transporting V-type ATPase, V0 domain	Interproscan
GO:0046961 all species →	Molecular Function	proton-transporting ATPase activity, rotational mechanism	Interproscan
GO:0051117 all species →	Molecular Function	ATPase binding	Interproscan
GO:1902600 all species →	Biological Process	proton transmembrane transport	Interproscan
GO:0000220 all species →	Cellular Component	vacuolar proton-transporting V-type ATPase, V0 domain	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02154	ATPeV0A, ATP6N; V-type H+-transporting ATPase subunit a	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023525-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

151.8Max TPM

83.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	86.88	107.91
polyp at pH7 6	18	18	82.12	120.80
coral polyp · control treatment	16	16	85.74	101.70
coral polyp · oil and dispersant treatment	16	16	91.09	101.90
coral polyp · oil treatment	16	16	89.10	109.92
coral polyp · dispersant treatment	16	16	64.83	92.22
Polyp	10	10	89.81	151.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	107.91
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.13
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.11
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	104.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	104.23
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	103.50
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	101.82
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	101.61
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	89.62
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	85.37
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	76.86
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	71.60
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	70.99
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	70.23
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	68.55
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.21
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.01
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.52
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	120.80
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	118.31
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	92.95
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	91.48
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	90.99
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	90.98
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	86.71
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	83.18
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	78.10
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	78.01
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	77.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	77.04
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.50
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.28
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	66.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	62.90
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	61.52
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	101.70
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	100.79
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	97.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	96.66
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	96.10
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	94.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	93.51
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	91.54
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	86.73
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.92
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.51
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	75.02
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.76
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.91
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.77
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	101.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	101.79
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	101.15
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	100.01
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	99.64
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	95.67
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	92.48
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	92.35
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	89.90
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	89.31
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.50
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.44
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.34
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	81.92
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.46
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	109.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	109.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	108.28
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	102.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	94.25
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	93.55
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	91.20
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	91.00
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	86.20
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	80.79
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	80.71
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	79.98
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	77.46
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	73.67
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	68.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	92.22
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	83.61
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	79.82
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.93
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	73.71
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.71
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.57
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.39
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.91
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.91
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.18
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.86
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.90
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.68
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.66
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	151.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	136.23
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	124.12
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	112.81
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	101.90
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	85.46
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	59.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	54.92
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	40.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	31.60

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.