Gene detail

Detailed information of OS493_023565-T1 in Lophelia pertusa

Genomic Location: scaffold_105:353413...360821
NR annotation: KAJ7378318.1, U7 snRNA binding [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023565-T1

ATGATGGACGAAAAATTGGATTTCTTATCTCGAACGTTCGACCCATTAAAGGCTCTTTACGCCAGAGACCTTCATCCACCAGTACCCAACATACAGATATTCAACAACCTCGCAGAATATGCACTTGCAATCAAGGAAGGCAAAACGAAGTCAACTGAAGCCGTGAAGCCCAGTGGAAAGGCTTCATTGCGGCAGGCTGCTTCTAGAACAAGAAATCTAAAACCAGAATTCAAACCAGCTGAGAAAGAGGATTTGAAAGAAAGACTCAAGGCCATCGCCGAGTCTAAAGCGAGTAACACAGGGGACAGAAAATTGGAGAAAAAGAGCGACGCCAGAATGGATGACTCGAAACTGCAGGAATTTATTTTGGCCGAGGAAGCCTTCAAAGCAGAACAAATAAAGAAAAAACGGATGGATGTGATACAAAGGATGGAAGATCTCGCGGAAGGTCCTTTTAGTATACTGCACACTTGCCTTACCGAGAGGCGGAGAGTAAAAGTGTGGACAAGGAGACACAAGGGGCTGCGTAGTGTCTTAGCTGGATACCTTGTTGCCTTTGATAAGCATATGAATATGGCTCTTTTCGACGTCGATGAGGTTTACACTTTAGAGGAAAGAATCGAACAACCAGAAGTAAAAGATGAGTCACTAGAAACAAGGAAGAAAAAGAAGAAGAAAAAGAAAAAAGTAAAATCGCCAGAAAATGAAACACCAGATGAAACCGTGAACAATAAAGCCGTTGACAAAAATCCCTCCTCATTAGTGTCGTCTGGTGAAGTCTTGAATTCACTAACAAATGAATCATGTGGCGAAGAAGGAATTGTTACAATGGACATCGACAGCAGTTGTATCCATGAAGCGCCTGCTGCTCAATCCATTACTGGTTTGCAGACTAACACGGAGCCGCTAGTTTTACTTGCTACTAAGTGTGAAGATTCCACGTTTGCAGACTGTAACAATAAGGAAGGTAATTCCGTTTGTGACCTTTCTATGGCCAGTAGCGATGAAGAGTCTTTGGTGCCTTCAGCAAAGGCTCTTAGCGTAGCCTTACAAACTACTATCATTCCTTTTGGTCATGCTGAAGGCTCGCTTCTTGCAACCGACGAGGACGAGACAGTTGCTGCCGGTAAATGCTCTCTTGAGCAACACAGAGATATTTTGGATTTGAAGGCAAGCATTGATGCAGTGTTAGAGGACAGTGATTTTGATTCTGATTCTATAAAACCTGAATCACCACATCTGTCGTGTGCAAGTGATTCCAATAATGAGAAAGGCATTAGCGAGTTTAATATTTTAATAGTCAATGCTGAGGAATTTGATGAGGAAGAGGTCACGCAGACTCTACAATGTGACTTTGTGGAATTGAACACACAGGAAACTGTAAATGAGAACATACTCTCGCGTCACGCAGATGTAGAGAATGTTGATAAAGGAGTCGGAAACAATAATGATTTCAATCTTCCCCCATCTAAGACTGAGGATCCTGATTTTGTTGTTTCTGCTGATGCTCATGAAAGGGACTTCAGTGTATCAGAGGACAGTGATGTTTCCGTTACCACAAATAATGCGGTAAGGATATTTCCTGAAGCATCAAATATAGAGCATTACGGAAATCTGGCAGCAACTCACTGTAGTAAATCGACAGGGCTTCCAATGGACGTGAAAGACAACAGTGATGTTACTGTAGATGGCAGTCTGTTGGAAAATAATGACATTAGTCTCAAGGAGGAGGAAAGTCATTTTCAAAATGACAGGGAATGGAGTGTTAGTTCCGTAAGTAGTAGCAATTCTCCTTTGATTGAGTTCGAGTCTTTGGAATTTAGAGAAAGTGAAAACTACGTTGAGGAACAATCCCAGAATAACAATGAGTGCGCACCACGTTCAGAGGAGGTTGAAGAAAGCCCTGATAGCTCATTAAGCGGTAAAGCGGCAGTACACGATGTATCAAGTTTGTTTGAAGGTCAACCAGGTTTGTCCAAGTTCAACAAAAGTTTTGGAATTAACTGTACAGTTGAGGAAGAGGAGAAGAAAGTGGTGGCAAGACACTTTCAGGTCAAAAGTGAATGCACGGAGGAGAACTTAGAAAGTGGAAATCTAGCACAAAACGTCGGTGGAGTGACACAGTTACGAAGTAAAAGCAACTTGGGAAAAGGAATTGCCGATGTATGCTTAGATCACAATTCTGTGGCAAATAACAGAACTGTCATGGATCAGGTGTCAACTCAATCAGTTACTGTAATTGTTTCTCAGTTGGAACTGGATGCTGTGGACCCAGTAAAACTTCCAAATGAAACTATCAATCATCCAGCGGGCAATTGTGAAACCACTCAAGCTGCGGAAATATGTGAAGGTATAGAACGTAAAGCTACTGAAATAACAGAGAGTGAACTTTCAAATTCTTCGAAAAGTATTTATGGCTTAACCGATCAAGAAGAAACTAGCTTGTTCAATTTCCAAGAAACCACTCCAGAATTCCTTCTTGGAGAAGGGGACCAAGTTGGTGAAAGTCGCTCGAAAGAGGAGTATCCAGCCATTTGTGCTACCACAGAAGCTAGAAGAACAACTGAGATGCACTTGCGATCATTCTCGTCGTCTTCCACGGATCTTCAAATCGATTCATCAAGTTACTCGCTCACTATCCCTCCACATGAAGAGACAAATGATACCTCAATGGCTTTAGATTTTGCTTCAAAACCTTGTGTCAAAGGACATACCAGTGAAAGTACTTTAAATGGAGTTGTCGAGGGTGTTGATATCATCCAAGACAAGATAGAGCATGCAGTTGGCACTCAGCAAGTAACCACAATCGGTGCTGCAAGTAACTATGGCATTCTTACCAAAGTAGGTAAGCGCTCTGATCTTATTTCTTTAGAACCTACTCTTGATGTTCCTGGAGAACGTTTGAAAGGCTCTGAAGGTCCATCGGAGGAGAATGAAACAGTATCAAGTGTTACGCCATGTTTCGTTTTGGAGCTAAATTCAGAAAGAGGACTTTCCAAACATGAAGAAATCAGCCTAAATATACACGCATCCGTGAATAACCGAGGAGATGAATGCCAGCACATCGGTAGCGATGAATCTGGACAGTACAGTGTAGAACAGTCTGTACATGAGCAGTCAACAATCTCAGAAGAAGTATCAGAAAAACAGCAGATAAAGACATCACAAACTGGTCAAACTGAAACACAATTTAGCGAAGCAGAAGTTTCACATGCATTTTCAGATCGAAACGAAGACAACGTATCTGGCAAACCCGATAATCTCCTTACATCACTGGATAATTTGTGCAGTACTTCTTTGCCCCATGAAGACAACACTAAAACATTAATTCTGCCAGAAAAAGGGAATGACGTGAAAAATGAATCTCAAACTTCTACTTCGGAAGATTTGACAATGGTCTCCACGACCATGAATTCCAAAGACAAAGACATGCCTCCCAATAAAGGAGCAGGGCTAAACACCGAGAAACAAACCAAAGAGGAGACAGATGTTCCATTGCCAAGCAGAATCGATGAATCTAAACCGAGGGTAGATAAAGATGACAAAGAAGAAGGCGAAATTACTTCCGATGAAGATGATGATGACACTTCACAGACTCAAAAACCGACAGATAAGGAAAGGGAAGAAGGTGAACTTTCCACGTCTGATTCTGATGTCGAGGCTCATATTGAAGCATCGTCACACGAGAAGCAAGGAGGAGCAGCTGTTCCTGGAAATAAAGTTCCCTTAGACAAAAATGTATTCAATAGGAAGGGAAAAGAGCTGTATCCTACCAGACGACATTCTTCGAGTGACGTGCATCAAAAATTATCCAATGAAAAGTCTAGAGTGCCTGAAAAATCAAGTAGTAATAGAAGAGCTTCTTCATCTTCTTTTAAGAACAAAGATTTGCGAACAAAACTGAGCGAAGCACGTAAAGAGCGAACATCGATAAAAGGTACATCGTCTGGTATTCGTGAAACGCGAGAAGATCGCCTTCGCAGAGAATCGCGACCTGTTGAAAAAGGTGTGAAGAAGATTGTCACTGAGGGGAAGTGTTGTGCTAAAAGTGGTAACAGAAAGGGATCTAGTCAAGGAAAAAAGGTTGTGCGCGATGGAACGAAAGCTGGACGTGAAGCAAAAGTGAGAAGCCTTAAACCAGAAGGGGCTTCTCAAGTAAAAAGACGAGAGACACGACAACGAGTGACTGGGACCTCCGATGAAGGCAAACCTAATAGCAACCAGAGAAGGGATGGAACATCAGAAAAAAGTCTAAAGTCTGCAAACAAAGAAAAAGCAAAGCCTAACAGTTCTCTACAAGGCAACGTTAAGGTAAAGAAAATGAGTCCAACAAGCTCAAGACACAAGATACTAGATCGTAACGATAAATCTCTGCTTGAACCCAAGAAAATAACGAAAGTATCGACAGCTCGTCGTGAGGTCAAAGGCAAGAAAAATACAGAAAAATCACACAGTTTACAGAGTTGTGAAGCGAAGGTAAAGGATAAAGAATCAACGATCAATCTTGACACTTCGGCAACCAAAAAGACAAGTGGTTGTAAGAGTGAAGGCAAGAATACGGTGAAACATGCACACGCTGTATCGAAGTCAAAATCAAATACATGCTTTCAAGTCTCGGACTCAGGAAATACGCCTTCACGTGTTAAGAAAGAAAAGATTAAAAGTAACACAACAGTGAAGTTATCTCGTCGTGGTAAGGAAGCTGATAAACACCCAAGTAAGTCTTCCATTGGGAGCAGTCTAGAGCCTCACTCTGAGAACGAGACAACAGCAAAGAAAGCCAAAGTTCTTACCAATCCAAAAGAAAGTAAGAAGGCTAGCTCAGTTGCTCTCAGTTCACAAGGCAAAGTGCAAAATAAGCCTGAGAAGCGTGGCAAAGTGAAAGATGAAGCAAAAGCAGTGGGTGCTAATGTTGTAGGAAAAGGTGACCACATTGACCAAGGTAAATCAGAACGAGCCAAGACCATGGTCAGAAAATCTCCTCGAATTGCCCCAAGAAAAGTGCTTAAAAAGTTGCCTTCCAATGCTACCTCCAAGGTAAAAATACAGCCTCGACACGGTAACGTGGATCGCACAGGAAATCCCAGAAAGCGTCCCAGAGCTGTAGACAACACAGAAGTGAGGCAAGCAAAGAAATTGCGACTCGAAGAAGGAAATAATCCATCTTCAAACGATGCTTCTACAACTGAGATTCCTAAACCTTCGACGAAACATGGCGAGTATAACAGCAATAGAGAGAATCAACCACCTTCCTGCAACCTTGAGATTTTTGAAAATAAAATGTCCCTAGCTAGCGGTACGAAACTCAAAAACGCAGATGAATATACGTGTATGGATGAGTCCAAGAAAACCTCTAATGAAATTGACAGCAGTCGGTCAAAGACGATTTTGATTGGTCGTGACAAGTGTTTGGTATTTAAGCGTCGTCATGTAAACCAGTTGTTTATCAGAGGAGATAACGTTGTCATGGTGGCATACTCCAAGTGA

Transcript

OS493_023565-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007761 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_023565-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR010920 all species →	Homologous_superfamily	LSM domain superfamily	Interproscan
IPR034109 all species →	Domain	Sm-like protein Lsm11, middle domain	Interproscan
IPR039267 all species →	Family	U7 snRNA-associated Sm-like protein Lsm11	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21415 all species →	U7 SNRNA-ASSOCIATED SM-LIKE PROTEIN LSM11	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005683 all species →	Cellular Component	U7 snRNP	Interproscan
GO:0006398 all species →	Biological Process	mRNA 3'-end processing by stem-loop binding and cleavage	Interproscan
GO:0071209 all species →	Molecular Function	U7 snRNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023565-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023565-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

6.0Max TPM

0.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	0.87	1.75
polyp at pH7 6	18	17	0.94	1.98
coral polyp · control treatment	16	16	1.47	5.96
coral polyp · oil and dispersant treatment	16	16	0.86	3.11
coral polyp · oil treatment	16	16	1.05	1.97
coral polyp · dispersant treatment	16	16	0.62	1.38
Polyp	10	10	0.74	1.02

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.75
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.49
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.38
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.32
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.15
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.98
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.90
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.89
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.80
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.74
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.73
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.69
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.67
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.62
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.49
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.48
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.39
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.23
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.32
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.25
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.20
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.07
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.04
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.83
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.64
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.63
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.54
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.51
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.48
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.48
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.39
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.96
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.24
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.10
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.94
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.66
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.41
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.36
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.29
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.27
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.88
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.82
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.70
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.44
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.28
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.23
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.11
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.52
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.20
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.00
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.75
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.59
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.47
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.45
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.44
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.29
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.19
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.14
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.97
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.89
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.79
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.45
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.31
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.31
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.28
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.00
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.93
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.66
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.60
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.47
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.46
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.34
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.28
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.23
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.97
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.67
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.57
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.55
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.36
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.32
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.25
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.13
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.10
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.02
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.99
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.85
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.82
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.81
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.76
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.74
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.61
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.61
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.16

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.