Gene detail

Detailed information of OS493_023600-T1 in Lophelia pertusa

Genomic Location: scaffold_105:707672...710190
NR annotation: KAJ7378346.1, helicase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023600-T1

ATGGAGAGGCGAGTTCCCTATCCACTTGGCATTATAACCAAGAAGATTCGCAGAGGCTGTGATCTTCCTAACGCGTTCAAGCTTCTCAATGCAGAATATCAGTTAAAGGAGACTTTTCCAGAAGAGGTTGCCGAAGAGGTAGAAAGACACAAGAGCGACTGGTCGAGCATCCCCGAGTGTGAGCGTGTGGACCGCAAACGAGAACAAGTGCACAATGCATTTACAATTGATCCTCCCGGAAGTAGAGCTCTGGACGATGCCTTGACGATTGAAAAACTAGAGAATGGTAATTGCAGAGTCGGAGTTCACATCGCTGATGTGTCTACCTTTGTGAAACAGGGAAGTAGAATCGACATTGAGGCAAGAAGGAGAGGCACCTCTTACTTTCGAGGTCATCACAATGGAGATGTTCTTATGCTTCCGAGGAAGCTAAGCCATGACATCTGCAGCCTGTTGCCGAATAAGGAGCGACTTGCCGTGTCTGTTTACCTAGTTTTGGACCAAGATGGTCAAGTTCAGGAAGAAGACAAGCTTGATGTTCGTCGAACAATAATGAAGTCACAATGTCGTTTGACGTATGCTGAGGCACAAAGAGTCATTTTTGGAAAGCCTATTCTTAACAAGCCTGCCAGAGATGGACAAGTTACAGTCAAGATCAAACAAAGTATCTGCACGCTCAGTTCTGTAGCTCAGAAAAGGAGAAAAGTACGTCTTTCTGACGGATCTTTCTATCATTTTGGCTACGCTGATAGAAAGGAAGACCTCGAGGCTCATGAGTTGGTAGAAGAAATGATGATCCTAGCCAACACGTCTGTGGCCAGGTATCTTGTTCAGAGGAAAGCAGCGTTGTCTCCTTTGCGGATCCAACTTCCTCCAAAGACGCGCAAATTGGATGAGTGGAGAGAGAAGTTTGGGGATTGTGCCAAGCTTTCTCTTTCTCTTAGAAGGCATTTGCGTCAAGATGTCGAGTGTGTGGATAATTTCTTTGTGCCAAAGTCTACGTGGAATGTTATTTGTAATGCACGGCGCCATGAAGGGGATAATAACACTGAGTTAACGCAGTTAATCTGCAATGACAACATCTATCCTCAACTGGCAGTTTCACGCTCATTTCTGAATGGACTGCAAAGGAAGGCTGAAGATGTAAGAGCAGCCGACGTCCCAGTGGATCACATAGTTTCATTGGTCCTTGAACGGCAAGACGTGGAGTCCGAGGATATCTCCGAGCTTTATCGCAGGTGGTCATTTTTATCTGAAAGGTCAAATAAGTTTGAGAAAGATTGTGGTCGTGTCCAATTTGCGGCAAATCTTAAGGAAAGGACTTGTGAAACTGTTGCTGTCATTGAAATCATTGCTCGGGATTCTCTTCAGCTGCAGCTGTTGTCTGATGCCAACCAGTATCTTTCTCCACGACAGAGGAGAGTTCTGATTAGTCATTTGGGACCAATCAAGCAACCCGAATTGGTTGAATCGTCAAGATGCCTTGAGCTAAAGTGGAAGCTTCGCATTTACGATGCTAGTACTGAGAATATGAACCCGGGAGCGAGGCGGTGTAAGACCCAGAAGATGCTGGACAGACATCTCCGTAAAGACAGATCTAATATTCAGGCTATGCTGTCTGCCGACTCTAATGGTTCAGGTCTTGGTTACCACATTCCTAGCAGTCTTTGGCTAGAAGTATTGGATGCCGTTAAAGACGATGACGGTAGAAGGTTGGAGCAATGCTTAATGGAAATGGATACAGAGATTGCAATTGAAGAAAAACAAGCTGAAGCAGCAGCAGCGGCGGCAGCAGCAGAAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAAGAAGAATACGAGGATGACGATGAAGAAGATGAAGATGATGACGACGATGATGAGGATGAGGATGAGGATGATGATGAAATCGATGCAGAGTCGCGTCAAGATGAAGAAGAGATTGGAGGACTAATGTCACCAGATATTCAGCTCTTTAAGCTCGCATCTGGAATTAACATCTGCCTTGAGCATAGAAAGCTTCCAGATAACTGCTTTGCAGCCTTTGCGTCAGAAAAACCGTCACAGCCAAGGTATAAGAACATCCAACGTTATCTCACAGCGTGGAAACCAGTACTGGAATTGGAGGCCGCTACAGTGGCTGTAACAAATGACGATGCTTTTATTCTTCAAGATCTTGAGGTGAAATGGAGAGAAGATGATGGAAAAATTTTCGGCGAGTTTCACCTAGATAGTAACTATTGCGAAACAAGACACATCACGATTTCAGAGGGGATTATGCTTGTGTCAGGGTTTGTTGTCCACTGTCTGTACAAACCAATCTGCCTAATGATTCTGAGCGGCTTATGA

Transcript

OS493_023600-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9BYK8	3'-5' exoribonuclease HELZ2 OS=Homo sapiens OX=9606 GN=HELZ2 PE=1 SV=7
O14040	DIS3-like exonuclease 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=dis32 PE=1 SV=1
Q0V9R3	DIS3-like exonuclease 2 OS=Xenopus tropicalis OX=8364 GN=dis3l2 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000671 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00773 all species →	RNB	RNB domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001900 all species →	Domain	Ribonuclease II/R	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR050180 all species →	Family	RNR Ribonuclease	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23355 all species →	RIBONUCLEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0004540 all species →	Molecular Function	RNA nuclease activity	Interproscan
GO:0000175 all species →	Molecular Function	3'-5'-RNA exonuclease activity	Interproscan
GO:0000932 all species →	Cellular Component	P-body	Interproscan
GO:0006402 all species →	Biological Process	mRNA catabolic process	Interproscan
GO:0010587 all species →	Biological Process	miRNA catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023600-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023600-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

41.9Max TPM

12.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.04	26.98
polyp at pH7 6	18	18	14.55	29.52
coral polyp · control treatment	16	16	12.82	41.87
coral polyp · oil and dispersant treatment	16	16	10.90	31.65
coral polyp · oil treatment	16	16	9.66	22.73
coral polyp · dispersant treatment	16	16	10.34	26.37
Polyp	10	10	10.09	36.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.98
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.97
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.32
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.90
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.94
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.56
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.79
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.19
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.91
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.89
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.36
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.32
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.66
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.61
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.99
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.76
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.73
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.73
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.52
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.12
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.22
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.55
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.50
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.15
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.16
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.88
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.79
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.55
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.43
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.14
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.68
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.90
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.87
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.76
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.05
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.06
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.12
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.10
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.91
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.09
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.02
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.72
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.53
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.29
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.19
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.64
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.20
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.65
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.45
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.72
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.58
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.79
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.77
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.25
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.03
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.55
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.54
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.35
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.83
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.82
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.73
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.25
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.70
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.95
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.05
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.91
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.06
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.98
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.66
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.59
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.22
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.97
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.57
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.86
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.32
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.74
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.37
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.13
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.23
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.67
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.01
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.13
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.47
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.42
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.11
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.29
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.92
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.39
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	36.76
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	13.32
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.39
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.20
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.01
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.37
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.39
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.14
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.68

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.