Gene detail

Detailed information of OS493_023733-T1 in Lophelia pertusa

Genomic Location: scaffold_106:1052932...1064695
NR annotation: KAJ7371702.1, hypothetical protein OS493_023733 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023733-T1

ATGGCAGAGGTTCGCAAATCCGAAGGCTACACACTGTTAGTTCTCGAGATTTTCATAATCATCCTAAACACTTTAGCAATCATAGTTATTCTCCGCTTCAAAAAGAAATACAACCCGGATATTTTGATCTTCACTCTCGCCGTTGCAGATCTGCTAAAGGCGTTTATTCCGCTGAACATGACTTTGGTCGCTTACCTCGATGGCAAAGCAATGACGGAAGGTTCTCTTTCGTGTAATATTTTTGGCTGGACAGCTTTCACTCTAAACAGTGGAATAATGCTTGTGATGACGGTAATGGGAATCGATAGATATGTCGCTATATGCTGGCCTTTCAGATACAAACATTTTCTTTCAAAGAAACGACTTATTTACACAATCATTGCAGTTTTTGCATTCAGCGGGGTCCACTCTGTGTTGCCTTTGATAGGAGTTGGCAAGATGAGGTCGTATAATAACGGAAGTTTTTGCCATTTTGACTTTGATTCCACGATTCCCGCGTGCATGGGCTACAGCATTTTCGTTCTGGTTCTGGGGATTTCTATGCTTGTAGTTGTGATATTTTGCTACACACGCGCAATGTTTAGTGTCAGGGGGCTTATTCATCGCCAACGTCGAATGTCCATTCCTACACGGGACATCGATAGAGCGGATCAGAAAAGACAATCGATGAATCGTATGTTCGCTCGTCTCATGATCGTTATGATGATGGCGTTTTGTCTTTCGTGGCTTCTCTTCTTGATCGTTGTTCTTCAACACGTGAGTGGCTGGTTCCAAATCGCCCCTGGAGCACATTTCTGGTCAATGCGGCTAGCTGTTGTCAACTCTGTTTTTAATCCAATAATTGGTGCAGCGATGTGCAAGCCATACAGAAGAGGATACCTGGTTATCTTGTGTAAATGTCTCCACTTCTTTGGTTTGTGTTCGTCTTACAATGCCGAAGATCCCTGGACGCGTTCAAGGAGAATGTCCGTAGGCTCACGGAACAGTTCTGACAGAGATCAAAACGAGCCGAACGCAAATGACACTGTCAGAAGCAACATCAGGAACAACCCCTCATTCAACAGCTATTATGATTCTGGCATTGTTCCCGATAGCAATGATCCTCCCGGAACTCTCGGGTATAACCAGGATGGAGTGGTCAACGCCGCTTATGAAATTGACGCAAGCCTTGCTAGTGCAACTCAACATGTCAGCGGAGTTGGCAGGATAAAAACACGGCCAAGGCTGAACACAAAGCGCATTTCTTTTAAAGATGAATTGGAGGCGAAACAGATAGCTGGAATGTCATTTAATGGAGAAGAAGCTGTGGAACCAATGGCCATAATGCCCGATAATGCAACCAATCCACAACAGCAACAACAACAACAACAACAACAACAACAACAACATGGAATTAGTTTGCAATATAGTGGTGCAGAAAGCGGCCTGACAAATACTTCACATGAAAACCAATCTTCTTCTGAGTTCGCTCCAACTGGAGACATCGATAGAATGATTATAATTGGTTCAGATGAAAAGCAGAGACGAAAGTATGGTTTTACAGATGTTCATCTGTCTACATTTAAGACACTTGAACCGTCCTCACTTGTAAGACCACCAGGAGATGGCGAATTGCTTCGCACATCAAAAGGCGAGGCTAGTACTCTAAAAGGAGGTGATCATATAGCGGAAGAGACAACAACGCATGGAATAAAATCACCGTTAGACAATAGTCAGCTGGTGTCTAGCAACGGAGAAGCAACGGCGGACACTTTACAAAAAGGTTCAATTAGCGATGAGAGTGAATTAAATTTGAGTGAGTATAAGAAACCATTAACGCGCGACAAGAGTGAACATTGTCATTTGACCTCATCAAAGGATAATCACGGACAAATTCAAGAACAGTCATCTTTTCGCACAGTTCAAATCACACATTTTCCAGTTGGTACAGACTCTGATATAAAGACAACCACGATGAAATCGCCAGTTTTGACAAACATTCAGCGGTCAAAATCATCCCACGCTTTTTCACCATATTCGTTGAGGAGCAGTTCGTTCGTAGAAGGAACTCGGATAACATCACCACGAGGACAAAAGCCGCGATCTCGGTCATTCGCGAATGACTTTAGTGCTTTAGATGTGGGTAGCGAAAGTAGTATGATAAATGCTCCTGAGAATACAACACGGAAAATACATGATTCATATGAACGGCAGCATTCTATTCATCCAGCGACTCCAAGCCGCGCTTACGGCGCTGGTGTTTTGTTTGACACTCAGAGATTCAAATCTGATGAAGCTCTTCTATCAGAGTTTTCGCCAAACCTTAGTAGAACAAAGAGCTTTGAATCAGCGCTAAGCAATCCCCACTGCAAGTCGGACAGCACAGCGTATGGCGGCCATGACTTGCCGCCGTTTCAAAGACATCCTTCTGCTCATAAAGGGGAACAGTTAAAAGGGACTTGCACCTGGAGGTATTCGGAGCCTGATCTAACTCGCACATTACCGCAAACAGTTTTTCAAGCTTCACCGTGTAGATCACCGGACGCAATGCATAGTGGGAGCCTTATGGCTGGGGACGCAATGCATAGTGGGAGCCTTATGGCTGGGGGACAGCGAGGCTCATTAATCTCCGGGCCAGACAGCGAGGACTATAAAGAATTAGAAAGTATGGACAGTTACCAAAGAAGGGTTTCCTGTCCCCAGATTATACCGCTGTCACCAAGAAAGATGTATGAACAATTGAGCGAGCTGAGTCAGAAAGATCTAGAACGAGAAGTTTTCTGTTGA

Transcript

OS493_023733-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P41144	Kappa-type opioid receptor OS=Cavia porcellus OX=10141 GN=OPRK1 PE=2 SV=1
P41145	Kappa-type opioid receptor OS=Homo sapiens OX=9606 GN=OPRK1 PE=1 SV=2
P33534	Kappa-type opioid receptor OS=Mus musculus OX=10090 GN=Oprk1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007909 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00001 all species →	7tm_1	7 transmembrane receptor (rhodopsin family)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000276 all species →	Family	G protein-coupled receptor, rhodopsin-like	Interproscan
IPR008365 all species →	Family	Prostanoid receptor	Interproscan
IPR017452 all species →	Domain	GPCR, rhodopsin-like, 7TM	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11866 all species →	G-PROTEIN COUPLED RECEPTOR FAMILY 1 MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004930 all species →	Molecular Function	G protein-coupled receptor activity	Interproscan
GO:0007186 all species →	Biological Process	G protein-coupled receptor signaling pathway	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023733-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023733-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

18.7Max TPM

5.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.47	11.13
polyp at pH7 6	18	18	7.77	11.81
coral polyp · control treatment	16	16	6.65	11.55
coral polyp · oil and dispersant treatment	16	16	3.57	8.29
coral polyp · oil treatment	16	16	7.45	18.72
coral polyp · dispersant treatment	16	16	2.93	7.49
Polyp	10	10	4.28	8.98

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.13
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.88
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.48
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.12
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.52
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.20
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.07
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.94
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.79
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.66
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.65
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.62
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.54
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.26
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.06
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.81
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.37
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.80
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.01
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.80
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.60
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.30
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.87
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.73
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.86
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.83
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.34
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.15
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.79
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.55
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.98
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.22
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.99
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.05
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.91
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.10
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.02
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.38
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.94
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.64
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.50
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.17
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.15
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.13
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.29
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.45
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.36
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.13
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.12
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.91
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.85
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.61
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.53
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.78
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.08
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.75
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.43
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.90
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.72
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.76
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.44
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.43
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.01
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.90
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.42
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.46
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.04
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.39
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.35
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.67
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.19
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.71
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.49
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.82
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.74
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.96
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.69
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.57
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.05
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.95
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.16
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.05
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.49
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.32
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.89
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.98
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.92
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.82
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.34
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.66
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.43
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.58
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.51
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.39
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.18

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.