Gene detail

Detailed information of OS493_023771-T1 in Lophelia pertusa

Genomic Location: scaffold_107:249342...273569
NR annotation: KAJ7357640.1, Domain abundant in complement control protein, SUSHI repeat, short complement-like repeat (SCR) [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023771-T1

ATGTTATTACTGCTATCTCTGTTGCTATTTTGCAGTGCTTCGCAAGGCACAGATTACACAATCATTGTTGAAACCTCCAGTTCAGATAAAGCCGGTACTGATGCTAATATTTATATCAAAATATCTGGCACCAAATACAACATAAAGAAAACAGATATTACAAAAAAAGGCAGCTATGAAACAGGAAGCACAGACACATTTCACATCCAAGACTACGACATAGGCTATGTGACAGGAATGGAAATTTCTCGTGACGAGGCTGGTTTTTTCCCCAACTGGAAACTTGACAAGATAACCATCAAGATCGCTGGAAAAGTGGACAGCTACTTCAATTACTATAAGTGGGTTAGCCCAAAAAGGTGGATTACATTACCCCTTTCTTGCCCGCCTGATCATCATGTGAACAGTCAAGGTTACTGTGATGTGTCAGACGTAAATGAGTGTTTGGACCCATCCACCTGCATCGCACCAGCCACGTGCGTGAATACCGTGGGCTCATACCTCTGTAACTGTCCCAGCGGTTACGTCTTGAAGCCAGGATCACATAAGGAGTGTGAAGATATCGACGAATGCGCCAAAAATCTTTGTGACTCAGTAAAGTCAACATGTGAAAACCTGCCTGGGGATTACCGGTGCAATTGCAAGAGTGGTTACCAGAATCTGAATCCCAAACAGTGTATAAATGCAGATGAGTGTAACTTGGGTACAGACTCGTGTGACAAGAAGACGTCAGATTGTATGGACACTGAAGGAAGCTACTATTGTCTTTGTAAAGACGGTTATACTCAGGGAGCTAATAACAAGATTTGTGTAGCCATCAAATGCGGTTCTTTGAGTCCCCCCTCTGGAAGCACTTTGGAACCAGCACGATGTACTCAACCCAATGCCAATATATTTGGAGACAAATGCGTCATGAAGTGTAAAGATGGTTACATCATTTCTGACATTCAGCACGGGGTTCTCACGTGTGGAAGCAGCGGCAGGTGGGAAGGAAATATGGGCACATGCAACCCTGTTGCGTGCCCAGCACTGCCCGCCATTTCGCATGGAGAAATATACCCGCGGAAATGTTCGTCAAGTGGAGGAAAATACACAGAGACGTGTACGTACAGCTGTGACAGCGGTTACTCAATGGCGGGCCAGGGGAACAGACAGTGCCAAGCGGACGGGACCTGGGGCGGAGCTGCACCAACTTGCAAAAAAATTGAGGTTCAGCCTTACAAGTTCCCCGCCGGTACGACGAAGGTGGAGTGGACGGCGACTAACGTGGTAGGATCGGCAAGCTGCTCGATTAATGTTATCATCCGTGATAAAGAAGCTCCCACAGTACAAAATTGTCCTAAAGACATTTTCGAAACTACCGATACTAACGCGGCCGCGGTGACCTGGGTCGAGCCAACCTTCAGTGACAATGTCAGGGTCGCGAATGTGGAGAAGTCACACAACAGTGGCGCCAGCTTTGACCTGGGTTCAACTAACGTCAATTACGTAGCCCTGGATGAAGCAGGAAATAGAGTATCCTGTCAGTTCACAGTGTCACTCAAGCGGCCACCATGTTACCCTCCTAATGGGCCTCTCGGTGTGGAGTCTGGTCACCCTGAAAACAATCCTGATTGTGTCGAATCCAAGAAGAAAGACCCAAACACTCCATGCGAAGAGAACCGAATTGAGATGACTGTGGTTACTTTAAACCAATTACACTGTACTAAATGTCCCCTTGGCACACACAAATCCTCAGCCACTGATTGCAGCCCATGTCCCGCGGGAACTTATAACGACCAACAAGGACAATTACAATGTACTCAAAATTGTCCCGCGGGTACTTGGTCATTGCCGGGAGCAAAAGCTGCCGAGGATTGCAAAATGCCATGCCCCGCTGGTAAGTACTCTATGACTGGTCTGGGACCGAGCTGTCAGGACTGCCCACGTGACATGTATCAGGACAAAGCCATGCAGAAGAGCTGTATTGCATGTCCAAGTGGAACAGTCACTGTCGCCCAGGGCTCAAGTTCAGCTGACCAATGCGGAGTGAAACCAAACGTCACTGCTATCGATCCACCTGTGAGCAACATAAAAGAAAAGGAAAGTGTGTCTGTAAATTGTTACGCAAGTGGAAAACCAACACCTACTTACAAATGGAAATTCCTGCGGGATATAAATGAGGACTTCCTTGGAAAGATGTCTCAAGTGAGACTGACGAACCCTAACGGTGATGTGATTGGTTCAAAGCTCGTCATTACTGGAGCCACATTCGAGAACACGGGGTCATACGAGTGCACTGCGACTAGCACGCACGGCAGTGACATGGGCCTAGCAGTCATCAATGTGGAGAAAGTCATCGGTCTCGCTGGCTCTGGCGACATGCCGAGTTTATAG

Transcript

OS493_023771-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000992 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02494 all species →	HYR	HYR domain	Domain	Interproscan
PF00084 all species →	Sushi	Sushi repeat (SCR repeat)	Domain	Interproscan
PF13927 all species →	Ig_3	Immunoglobulin domain	Domain	Interproscan
PF07645 all species →	EGF_CA	Calcium-binding EGF domain	Domain	Interproscan
PF07699 all species →	Ephrin_rec_like	Tyrosine-protein kinase ephrin type A/B receptor-like	Domain	Interproscan
PF01477 all species →	PLAT	PLAT/LH2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR009030 all species →	Homologous_superfamily	Growth factor receptor cysteine-rich domain superfamily	Interproscan
IPR000436 all species →	Domain	Sushi/SCR/CCP domain	Interproscan
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR018097 all species →	Conserved_site	EGF-like calcium-binding, conserved site	Interproscan
IPR000152 all species →	PTM	EGF-type aspartate/asparagine hydroxylation site	Interproscan
IPR003410 all species →	Domain	HYR domain	Interproscan
IPR036392 all species →	Homologous_superfamily	PLAT/LH2 domain superfamily	Interproscan
IPR001024 all species →	Domain	PLAT/LH2 domain	Interproscan
IPR035976 all species →	Homologous_superfamily	Sushi/SCR/CCP superfamily	Interproscan
IPR003598 all species →	Domain	Immunoglobulin subtype 2	Interproscan
IPR001881 all species →	Domain	EGF-like calcium-binding domain	Interproscan
IPR003599 all species →	Domain	Immunoglobulin subtype	Interproscan
IPR049883 all species →	Domain	NOTCH1 EGF-like calcium-binding domain	Interproscan
IPR011641 all species →	Domain	Tyrosine-protein kinase ephrin type A/B receptor-like	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24273 all species →	FI04643P-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023771-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023771-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

94.3Max TPM

35.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	49.70	68.29
polyp at pH7 6	18	18	48.38	89.92
coral polyp · control treatment	16	16	29.18	58.62
coral polyp · oil and dispersant treatment	16	16	30.71	68.16
coral polyp · oil treatment	16	16	39.70	94.32
coral polyp · dispersant treatment	16	16	25.88	61.46
Polyp	10	10	12.71	30.46

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	68.29
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.90
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.30
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.63
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.45
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.92
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.86
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.58
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.42
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.37
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.90
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.77
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.49
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.70
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.71
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.47
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.34
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	89.92
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	87.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.89
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.02
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.50
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.22
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.26
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.57
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.99
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.49
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.46
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.29
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.23
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.28
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.35
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.91
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.21
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.21
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.11
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.43
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.17
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.67
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.42
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.97
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.64
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.17
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.13
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.56
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.44
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.48
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.16
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.68
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.57
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.99
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.90
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.23
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.55
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.62
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.89
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.03
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.78
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.17
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.89
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	94.32
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.27
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.43
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.92
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.70
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.73
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.17
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.90
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.28
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.80
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.59
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.93
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.06
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.23
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.69
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.46
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.95
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.55
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.78
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.07
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.07
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.88
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.69
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.35
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.69
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.12
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.85
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.62
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.03
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.17
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	30.46
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	23.31
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	14.55
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	14.54
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.42
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	9.45
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.18
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.27
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.95
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.96

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.