Gene detail

Detailed information of OS493_023785-T1 in Lophelia pertusa

Genomic Location: scaffold_107:389561...396694
NR annotation: KAJ7357654.1, 5'-flap endonuclease [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023785-T1

ATGCAGTATCATCAACTAACATACATCCTGCTCAAAATTCTAGTGGGCCAGTCGTTAAAAGAAAAAGAAGAGGTGTTGTACCAGAACGCTTGCAATGGCGTTATCAGCTTCCATGGCCCCACCCCCACCCCTGTGTCACATGCCAGGAAGGGCGTGAAGGGGAAAGGAAAGAAAAATAAAGGTGGAAGTGAACTGCCAGCCTTATTGCTTAGAGATGACGAGACTGCTCAAAGAGCCGTGGCAATGAGAGCAGCGCAGGTCCTTTGCACATTAGAAGGCAATGATGATGATGATGATGACATATCATGCACTCCTGCTCTTGCTCCAAGCCGATTAGCCCAGAACATTCCAGAGTATCAACCCTCCCTTAATAAAGAAGCGCAAGGTGAACATCTCGCAGATAACACAGTCTCCAAGGATGACATTGTGACTAACTCAGATTGTACAGAAGTTGAAGACAACCTCATGGATGTAAACAGTGGAAGTGAGAGTGACAAGGGTGAGGAACAATCAAAGGAAGCTGTGGAATCTACTACTGTTGTTGATCCTTTGTTGAGCAAGTCATTTCTGAATTCATTGTATGATGTTGACATTGAGGAAAACCGACCAGTTGAAATGGAGGCAACCCTTCCCAGTCCCCTTTGGTCATTAGCAGCTGCAAAGGACCAGTCCTCTGTGACATTTTATGTTCCAGGCCTCTTGCCTCCTGCTTCACCAAGACGACCACAAAGACTTCCTAAACAGTTATCTGCTTCAGAGCCATCAGTTAAGAATCATAGTTTCCAAAATAAGGTGCATGAACAAACTGTTGATAATGCCGCAATCAAGGAAGACTCGAGTCACACAGCATCTGAAACAACAGTGGAGTCTGTCGCACAAGTGAATACAACTGAAAATGATGAATGTCCGGAGATAACACCATCACAAGCTGTTGATGTGGAAATGCTGTTGGAGCTTGTCGGTGAAGATGACATCTCTAACATGTCAATTGACTCCCAGCAGATGGCAGCAGCTAGTGGCTTCTGTGTTGACGAACAAGTGGAAGACAAGGGAACTGCATCCAGTGGAGTTCCAAAACTGCTTCAGGATTTATCATCAATGATAAACAACTCATATCTTAGCGATGTTGTTTTTAATCTGAAAGGTGGCCAGGAAATGGTAGCACACAGCTTTATTTTGTCTCTCAGATCGGAGGTTCTTGCACAGTTGTTGAAAGAGCAGGGAGCATTTTATAAGGAGACTGCATCTGGTGGAAGGAGGGTTTTTCTCAAGTTTGAAGACGTGCACCAATCAGCGTTTGAAGTTGTATTAAGACACATTTACGCTGGTGTTGTAATCATCCCTGAAGATTGTGAATTAGATGATGTAACAAACTTGGCTGAAAGGTTTAATTTGCCTTGTCTTCTGAATGCATGCAAGAAAACTCAGTCACAGCTGAAACAAGCGTGTGAGAGCCAAGAGGATGATGGTATGGATGAGTGCATTGCCACAGATGTGGCAAAACTCGAGGAGAATCTGTGGAAGAGTGATAATGATGATGACTGTCGTGAAGATTGTCAGACGTCAAAAGATAAGGATGAGGATGATTACTTGAATGATGATGATATTGAAGAAATAATGATCTTCCAAACTCAGTCGATTCAAAGAAATGGGAGTGTTGAGAGAGAAGATTTTAATGAGAGGCCGAGGCTCGACAAAGAGGAAGACATGTTGTGTACTTCTGTACAGAGCAAGTTTGGTGATGACTTTTCTCACGAGTCCAGTTCTCTCACTTCAGAGGAAACGGAACAGAAGTTGGGAACACTTCTTGAGGATTATAACATGTCACGCATTCCTGTCGAGGAAGGTAACGTGTCACATAATCCTGTTGAAGAAGGTCACCTGTCACGTAATCCAGATGAAGAAGGTAACGTGTCACGTAATCCTGTTGAAGAAGGTCACCTGTCACGTAATCCAGATGAAGAAGGTAACGTGTCACGTAATCCTGTTGAAGAAGGTCACTTGTCACGTAATCCAGATGAAGAAGGTAACGTGTCACGTAATCTTGCTCAAAAAGGTTACCTGTCACGTAATCCTGCTGAGGGTGGTGAAAACATCATGCGTTGTGACTATTCTGAGGAGGAAGAGGAAGTGGAATTGATTATGTCATGTGCAAAGGGAAAGAACGTCGAAGAAGAGATGATAATAATTATTGAGAACGAACAGCTTCCACTACCAGAGGAAAGCGTGAAAAAGAAACAATTGTCACAAGACAAGAATGATCAGGGTGCATGGTCTGAATTTGAAGAGAATCACCTGTTATCACGTGATGACAGAGTCTTATCACGTGCTTCCAGCATTGAACGGGTGTGCGTGAATGACGGTGAGCCAATAAGCGATTTGGATGATGTCGAGGCGCAGCCTGCAGATCACGTGCTAGGGAGAAGTGCTCTTGAAAGAGATCTGGAACAGAACTGTGTTGTTGATGAAGAATTGTCACATGTGGATGAAGCTGTCGAACTGGATTTCGAGTTGGAAATTGATGCTGATTGTGCAAATATCTGCAATGTGTCAGTTGATTTATTAGATGATGAAAATGAAGTAGAGTATGAAGATATAAGGGAAAAAGATGTATCAGATGAAATCCATGAAACTCTGCCCGAATTTAAATCTGACGAAAACAAGGATCTCGATCTTCATGTAGAAAGCAGTTACAAGGCTGCCGATGAAACTTTATCTCTACCGTCATGGGAGGGGAGATGGGATGATGAAGAAGTCTTTCAGGGGTCCCCATGGGAGGTAACTGTGCCGGACGATGCGGAAAGCGATGATGAAATGGAAGAAGCAGATGCGAATGAATCAATAACATTGATCAGTGACAACGAGGAAGAGGTTTGTTGTTGTTTAATGCTAGAAGTTAGAGCGGTTTTCTACATGTAA

Transcript

OS493_023785-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003697 (this species only)
Ubiquitin family	E3\|E3 adaptor Cullin RING\|BTB · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00651 all species →	BTB	BTB/POZ domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011333 all species →	Homologous_superfamily	SKP1/BTB/POZ domain superfamily	Interproscan
IPR000210 all species →	Domain	BTB/POZ domain	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21541 all species →	BTB POZ DOMAIN CONTAINING 12	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000712 all species →	Biological Process	resolution of meiotic recombination intermediates	Interproscan
GO:0033557 all species →	Cellular Component	Slx1-Slx4 complex	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_023785-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023785-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

27.0Max TPM

7.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.56	12.06
polyp at pH7 6	18	18	8.06	11.33
coral polyp · control treatment	16	16	10.31	18.38
coral polyp · oil and dispersant treatment	16	16	8.75	26.98
coral polyp · oil treatment	16	16	8.48	11.90
coral polyp · dispersant treatment	16	16	4.39	8.13
Polyp	10	9	3.16	5.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.06
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.35
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.18
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.97
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.89
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.98
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.89
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.53
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.98
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.27
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.96
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.24
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.21
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.15
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.93
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.96
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.72
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.33
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.26
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.20
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.88
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.68
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.54
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.35
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.57
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.53
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.42
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.20
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.92
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.47
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.43
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.03
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.70
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.38
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.85
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.60
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.22
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.81
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.71
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.37
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.18
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.86
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.85
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.62
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.98
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.21
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.98
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.50
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.47
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.63
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.37
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.29
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.18
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.40
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.42
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.35
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.15
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.94
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.83
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.58
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.90
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.74
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.65
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.50
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.48
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.05
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.90
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.79
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.08
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.62
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.57
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.54
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.77
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.05
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.80
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.13
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.72
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.11
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.70
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.10
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.02
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.38
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.07
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.02
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.84
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.82
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.23
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.25
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.48
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.75
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.53
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.19
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.71
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.93
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.38
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.07
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.57
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.