Gene detail

Detailed information of OS493_023913-T1 in Lophelia pertusa

Genomic Location: scaffold_108:643971...677199
NR annotation: KAJ7328643.1, Regulator of nonsense transcripts upf2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_023913-T1

ATGAATGAGGAAAAAAGGAAGGCAGAATGCGGGGAAGCGGAGCAAATTTCTGGGGACAAAAAGTGTGCAGTTGGAAATTGTACACGCGAAGCGGTGGAAAGCACTGGCAAAGTGAAGGAAGAGAAAGCTCCAAATCTTAACACCCCTGCGCCTCCAGAGAATGAATCTGCTGCAACTATGGGAATAAACGAAAGTGAGAAGGAGATGAAGTCTGATATCAACAAGCATGGAGATACCAAGGATGAGAGTAATAAGGAGGATAACAAAGTGAAGGAGGATGAAGATGAAGAGGAGCTGAGAAAAGAAGAGGAGCTGAGAAAAGAAGAGGAGTCGAGAAAAGAAGAGGAGGAAGTGCAACAGGCCTTAAAAGAAGCACAAGAGTTGGTTGAACAGAAGCTTGCTATGCGGGAGAAGAATCTGGCTGCTGTAGCTCAGCGACCTGACGAGTCTTACTTTAAAGGAAAGGATTCTTCTGTGAAGAAAAATTCTGCATTTATCAAGAAATTGAGGGCCATTACAGAAATCCAACGCGAGTCTTTGGAGCAGGAATTTGCTGGTTTGAACCTCTCAAGATATGTTCAGGAAGCGGTCGCTGCAGTTCTTGATGGCTTGGTAAAATTGAAGCTTGCTGATGTAAGATGTGTGGCACATATTTGTGGCTTGATTCATCAAGTGTATGGTGACTTCAGTGAGCCTGTCAAAAAGGGACTTGTAAAAATGTTTGACGGCTATGGCGGGAAGGAAGAGGAAAAGCTAGCTAACGTGAGTAAGTATCGTGTCACCCTGAGACTGTTAGGAGAGCTGATCATTGGAGGAGTGTTTCCAAAGCTGTCTGAAGGCATTAGATTACTGGGCACTATTCTGAGTAACATTGTCAATTGTGACAAGGAAAGCCATGTGTATGTCCAGGTTATCAGCAGCTTCGCTCGTCACTGCGGAGAGGACTTTGCTGGTTTTACATCCAGGAAACAAAGATTGATGGCCGAGAAACACAAGGTGGTGTTTCCAAAGTGCGGATTAGTTCCTGCTGAAGATCAAGCAGCGATTCATCAACAGTTACTGACTTACTACAAGTCACTGGCCAACCATTTGCTCAAAGCACACAAGGATCTTCAAAACAGAGAGAAGCAGAACAGGCACACTTTACTGACCAAAGGTGAATTACATCCTGAACGAAAGGAAGCATTTGAGAAGGCACAGAAGGCATATGAAAAGCTACTGGCCAACACATCTTCTTTAGCAGATATACTGGATGTAGACATGCCTGATTTGCCGCAAGATGAGTTTGTTCAACACGAAGCTGGAGGGAACACAATTGATGTTTTTAACCCCTTTAGGCATTCAGAGTATGATGGAAGTTCTGGTCTGTGGGAAGATGAGGAGACAAGGATCTTTTATGAAAATCTCCGAGATCTCAAGGCTTTTCTACCAGGGATCTTGTACAAAGATGAAGGGAAGAAGGATGAAGAGGATGAAGATGGTGTTAATTCTGTCGAGGATGAGAAACTGGACATACAAGAGTTGGAAGCCGAGGAAGAATTTGAAGAGATGGATGATGACATTGGTGATGAGGAATTTAATGAAAAGGAAAGCGAGGAAGAAGATGATGAAAGCTCCTCTGGTGAAGCAGCAGGCTCGTCCACTGGACTAGCTCTGGAAGCAATAATGCAAAGGCTGCCTACATGCGTCAACAAGGAGTTCATTGATGAGGTGGCAACAGAGTTCATGCAAACATGTAACACCAAGGGAAACAGAAAGAAACTTTGCCGTGCACTTTTTGGTGTTCCTAGAATAAGGTTGGATCTACTGCCGATGTATGCTCGTCTTGTGGCGACTCTTGATCCTTGTGCTCCTGACCTTGCTCCTGACCTCATGCAGCAGCTGAAGGGAGAATTCAGATTCCGCGTACGCAAGAAGGACCAAATTAATGTTGAATCAAAGATAAAGACAGTAAGATTCATAGGTGAACTGACCAAGTTCAATATGTTCCCAAAAGGTGAAGCACTTCACTGTTTGAAGATGCTTTTGGAAGATTTCACCCACCACAACATCGAGATGGCCTGTAACTTATTGGAAGTATGTGGCAGATTTCTGTACCGTTCAGCAGACTCACACGTCAGAACCAAAAACTTATTGGAACTCATGATGAGAAAGAAAGCTGTTCAGAATTTGGACAGTCGTCAATTGACTCTGATTGAGAATGCTTTCTTCTACTGTAATCCACCAGAACGACAGAAGGTTGCCCAGAAGGAACGTCCTCCTATGCATGAGTACATTCGTAAATTGCTGTATAAAGACCTTTCCAAAACCACAACAGAGAAGGTACTACGACAAGTTCGAAAACTGCCTTGGAATGATCCACCGATTGCCCTGTACGTAATAAAGTGTCTGATTCGTGTGTGGAACATCAAGTACAACAGCGTTCACTGTGCTGCTAACTTATTAGCAGGCATAGTGCAGTACTATGAAGATGTTGGTCTGTATGTTGTTGACGGTGTTTTGGAAGAGATTCGCCTCGGAATGGAGACAAACCTACAAAAGATGAACCAGCGTCGTGTGACCTGTGTGAAGTTCTTAGGTGAGCTGTATAACTACAGACAAGTGGAGTCACGTGTCATATTCAGCACTATGTATTCCTTTCTCACCTTTGGCAACAACCAGGAAGGCATATTATCAGTACTGGACCCTCCTGGACACTTGTTCCGTGTTCGTCTGATCTGCACTCTACTGGATACTTGTGGACAGTACTTTGATCATGGCAACTACAAGAAGAAACTCGACTGCTTTCTTGTCTACTTCCAGTGTTACATCCTAAAGAAGAAAGCTGATGCCATATGGCATGATAAACACCCATTTCCTCGAGATGTTGACTACATGGTGGCAGACACTCTTGAGTCCCTTCGCCCTAAACTTACCATGTATGCAAGCTTGGAGCTGGCTGTTGAGAGTCTAGAGAAGTTGAACAAGGAGCATCAAGAACAGATAGAGAAAGCAGCCCCTGTAGAACAGGACACAAGTAACCCAGACAACAGCTCAACTCAGCCACTGGCCATCCCCGGCATGTCTTACAGCGAAGCTGTCTCCGAATCTCCAGCTGCCTCGCTCAGTAACTCTCCTTGCCAGTCTCCCATGCTGCGCGAGGAAGATGAACAGAGTGAGACTGGGGAGAGTGAAGGCGAGGACGAAGACGAGGGCCCTGGACCCCAGTGGGCTGAATCCGATAGTGAAGTTACTGAGGTTGATATAAATGATGTGGACATGAACCAGGTAAAAGTACTTAGTCCCCCTAAGCCAGAACCAACCGTGGAGGACAGGGCATTCCTTGCAGCCTTTGACAAACTAATGTTAGATGACGTACAGAATCGCCGCGAAGAAAACCCCAAGGTGCCAAGCTTGGATGTAGCGGTTCCAATGCACCTTAAAGGACAAAGAGCTCGTCACAATAGTTTAACAGAAGAGAATGAGAACCTCAACTTTATTGTCATGCTGAAGAAAGGAAATAAAAAGGAGTTTAAAGACCTCCAGATTCCTCTCAGCTCTGGACTGGCGGCAAACATCCGGGACAGACAGATGGCTGAACAACAAGAGCAGGAGGAGGTGAAGAGACTGGTACTGAATTACAATCAGAGACAAGAGGAAGAGATTTACAATGAGATGCTAGCGCAGCAAAGACAGGCTGGCTCTGACCAGACTTCAAGGTCTCATCATCGCTTTAACAAGAGACGACTTCCAGAAAGCAATGACACAACCATGGTGTTTGCTAACTTAACCAGGAGACGCTAA

Transcript

OS493_023913-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2AT37	Regulator of nonsense transcripts 2 OS=Mus musculus OX=10090 GN=Upf2 PE=1 SV=1
Q9HAU5	Regulator of nonsense transcripts 2 OS=Homo sapiens OX=9606 GN=UPF2 PE=1 SV=1
F4IUX6	Regulator of nonsense transcripts UPF2 OS=Arabidopsis thaliana OX=3702 GN=UPF2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003459 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02854 all species →	MIF4G	MIF4G domain	Repeat	Interproscan
PF04050 all species →	Upf2	Up-frameshift suppressor 2	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR003890 all species →	Domain	MIF4G-like, type 3	Interproscan
IPR039762 all species →	Family	Nonsense-mediated mRNA decay protein Nmd2/UPF2	Interproscan
IPR007193 all species →	Domain	Up-frameshift suppressor 2, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12839 all species →	NONSENSE-MEDIATED MRNA DECAY PROTEIN 2 UP-FRAMESHIFT SUPPRESSOR 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000184 all species →	Biological Process	nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005844 all species →	Cellular Component	obsolete polysome	Interproscan
GO:0035145 all species →	Cellular Component	exon-exon junction complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14327	UPF2, RENT2; regulator of nonsense transcripts 2	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_023913-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

190.6Max TPM

41.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	41.18	56.17
polyp at pH7 6	18	18	41.53	49.98
coral polyp · control treatment	16	16	55.70	190.60
coral polyp · oil and dispersant treatment	16	16	44.19	142.31
coral polyp · oil treatment	16	16	43.67	58.73
coral polyp · dispersant treatment	16	16	27.98	43.59
Polyp	10	10	31.76	47.19

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.17
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.11
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.13
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.43
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.79
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.77
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.13
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.87
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.54
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.42
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.40
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.24
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.24
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.22
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.25
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.07
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.98
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.97
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.71
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.48
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.58
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.23
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.98
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.95
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.84
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.37
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.05
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.36
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.12
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.12
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.62
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	190.60
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.88
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.72
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.28
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.76
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.19
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.75
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.47
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.71
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.56
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.34
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.04
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.75
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.40
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.22
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	142.31
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	55.90
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.48
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.31
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.19
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.21
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.57
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.49
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.62
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.92
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.59
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.18
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.97
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.96
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.28
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.12
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.73
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.85
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.78
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.44
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.69
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.63
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.46
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.33
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.92
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.70
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.46
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.90
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.55
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.55
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.14
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.67
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.59
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.29
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.96
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.95
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.51
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.22
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.45
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.22
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.61
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.20
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.55
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.04
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.16
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	47.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	42.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	38.33
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	36.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	32.60
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	27.26
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	27.14
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	25.08
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	24.81
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	16.31

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.