Gene detail

Detailed information of OS493_024416-T1 in Lophelia pertusa

Genomic Location: scaffold_113:935229...949687
NR annotation: KAJ7357603.1, hypothetical protein OS493_024416 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_024416-T1

ATGAATACTGGTGATATACATGCAGTAGAGAAGAGTCCATTGGAGTTGAGACGTTCAAACAGTCTAGAGCAGTTAAGCCAGATTAAGTCAAGCAGTGTTACATCAGTTGGTAGTGTCAAAACCAGTGATCAACAGTCAGTGAACAAAGGAAATTCAACAGAGGGAACCAATGTGCCAGGCCTGGTATCACTACAAGATAGGATTGCTGAGGCTGAACAGAACCTAAAGAAAGAAATGAAAGTTCACACTGGATTTAAGACTATTTCTCAGCTTGTGATGACGGATCCTGTTAAGCAAAGAGAAATGGAAGCAAAGGTGTCACAGAGCCATCAGAAGATCACAGAATGGCAGGAGGAATTAAAACACCTCAAAGATGAGCAAGTCTTTCTGATAGAGTCACACCGGAAAAAAATGCTGAAGATTAAAATAGCTGACTTGGAGGCTGACCTAGAGAAACAAGTAAGGAGTCAGAGAAGTCTTGAAATGCTGCTAGGTGTAGTGGAGGAGAACAGAAAGAAAGAAGTCATGGAGAACATTGGAATGTGTGCACAACTTGTGGAGAAAATCAAAACAGAGCTAACAGAGTTAGAGGGTTCTCTGCACAGCTTAACAGAAAAACCAGCAGCGTCAAGCCAGAAACACATGGCTGAACAAAGGCAACGAGTCTTGACTGAACTCATTAATACAGAGAAGGATTACTGCAATGACCTTGAACTCTGTGTGAAAACACTTCCTTTGAAGGATCTTGACTGTGAAGGATTGTTTGGTAACATTGAGAGTATCCTGGAGACATCAAAGAAACTCTTGAACAGTTTAGAAAATGCCGTCCGAGACAAGGAAGGAAAGGATCAAGAACTTGGAAAATGTTTTATGGACATAGCTGAAGAAATGAAAGAAGTGTATGCTGTGTATTGTAGAAATCATGATGATGCAATCTCCCTCATGGAAAAGTATGAAGACGTACCTGAGATACAAGATGCCTTCACAAAATGTTTGGACAAAATTAGAGAACACACTCGATGTTGGGACTTGTCATCATTTCTAATCAAACCAGTTCAGCGGGTTCTTAAATACCCACTGTTGTTGAATGAGATGCTCAAGTACACGCCTGAAATCCACCGGGACAAGTACAACTTGCTGAGAGCGATATCAATCATGACTGATGTAGCAAATGCAATCAATGAGTTTAAAAGAAGAAAGGATCTCGTTGTCAAGTACAAGAAAGTAGAAGATAGTGGTTTGACCAACAAGATACAGAAGCTAAGCTGGCATTCAGTGGTGAAAAAGGGCTCCAGGTTTAACCAGAGGCTAACACAGCTCACAGGGCTTGTGTCGCAGACCGTTGATGAAAAGTTCATTGAAGAAGAGAAAAAGTTCCGCGCAATAGAGAAAACTGTGAAAACGCTGTGGAAGAATATCTCCACTTATTTGGAAGAATTTCAGGAGATTATGGAATGTCACAAGTCATCAGGACAGAATATCAGTGATTTCTATCAAGAAGCTTGCACATGTTCAGAGGTCTCCACTTATCATAAAACACAGAAAAGGATTGGAGAAACTATTCTTTATATATTTATGAACAGTGTTCAGATGCAAGTTTTGTCTCCGCTCAATTCCTTACTCAACTTGTTTCAAGGCCCGCAGCGTTTGATTCAGAAACGAAACGACAAGTGCCTGGATTATGACCGCTGGTCAAACAAGATTGACAAGATTAAAGACAGGGACAAGTTAAAAGCGGCAAAAGAAGAACTCGAACTTGCCAAGAAAAACTACGAAGCTTTAAACACGCAGCTGCTGGAGGAGATTCCTGGTTTTACTGAGATGTGCATGGCTTTAGTGGTGGACTGTCTGGAAAACTTTGCTTTGGCACAGAACAGACTTTACTATGAAATGCAGCAGGGCTATGAGCAGCTTTTACAGTTACCAATTGTGCAGGCAGTCGATGAGGATATAGTCGAGCATCACAGCAAGAGATCAACACAAGTCATTGAACAGTTTTCAGAGCTGAGCTTCATTCCGTGTAGTTTTGTAGCAAAAGACAGTTCACGCAAGAAAAGGCGATCAATGAGGAACTCCACCCTGCCTTCCCGCGATCCTGATGCAGTAGAAGATGATAATGAGATCAAGACCAGCTTATTAGATTCCAAAGAAGGTGAACTGGGTGGGGAGGGTGGGGTGGCTAAGAAAGGTCATGCCCCACCACCACCACCCTCTGCGATTCTACAACCACGTCCAGCGCCGCGGAGACTGAGTAGCACAACAAAGCTCGACCCCAAGGACGTAGACAGCTCACAGCGCGTGCAAGCAACTCAGGGGGAAGGAAAACCCTATATTGTCGAGTTCAACTTCGAAGCACAAAATGTGGGGGAGTTATCGGTATCCGAGGGGGATCTTGTGTCTGTCCTGCGACACTCGGACAGTAGTGGCAACCCAGAGTGGTGGCTGATTCAATACAATGGTGCCACTGGTAACAATGCAACGACGCAGGATTCAGATAGAAGAACAAAACGATTTAAAGAGGATAACACCGTATCCTCATCGCCGCATGAAACTACTGCTAACTTAATATACTACTATGTTGAATTTGCATTCGAGGCTAACAGTGCGGCAGAGCTGAGTCTGGATGAGGGGCAGTTTGTAATTGTGTTGCAGAAACAGGATTTGACAGGGAATGACGAATGGTGGCTAGTCGAGGTTAACGGCCAAAAAGGATATGTTCCTTCAAGTTATCTGACACAAGTGGAGGAGGATTGA

Transcript

OS493_024416-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E7F1U2	Dynamin-binding protein OS=Danio rerio OX=7955 GN=dnmbp PE=2 SV=1
Q6XZF7	Dynamin-binding protein OS=Homo sapiens OX=9606 GN=DNMBP PE=1 SV=1
Q6TXD4	Dynamin-binding protein OS=Mus musculus OX=10090 GN=Dnmbp PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004368 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03114 all species →	BAR	BAR domain	Domain	Interproscan
PF07653 all species →	SH3_2	Variant SH3 domain	Domain	Interproscan
PF14604 all species →	SH3_9	Variant SH3 domain	Domain	Interproscan
PF00621 all species →	RhoGEF	RhoGEF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR000219 all species →	Domain	Dbl homology (DH) domain	Interproscan
IPR004148 all species →	Domain	BAR domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR001331 all species →	Conserved_site	Guanine-nucleotide dissociation stimulator, CDC24, conserved site	Interproscan
IPR027267 all species →	Homologous_superfamily	AH/BAR domain superfamily	Interproscan
IPR035899 all species →	Homologous_superfamily	Dbl homology (DH) domain superfamily	Interproscan
IPR036274 all species →	Homologous_superfamily	HR1 repeat superfamily	Interproscan
IPR051492 all species →	Family	Dynamin-binding and Rho GEF	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22834 all species →	NUCLEAR FUSION PROTEIN FUS2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_024416-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_024416-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

47.7Max TPM

14.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.01	18.14
polyp at pH7 6	18	18	13.53	17.74
coral polyp · control treatment	16	16	21.04	47.68
coral polyp · oil and dispersant treatment	16	16	16.49	39.84
coral polyp · oil treatment	16	16	17.06	23.80
coral polyp · dispersant treatment	16	16	8.26	13.91
Polyp	10	10	6.92	12.84

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.14
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.73
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.35
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.92
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.92
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.44
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.99
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.93
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.02
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.83
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.55
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.27
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.75
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.30
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.71
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.74
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.83
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.58
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.38
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.56
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.47
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.25
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.93
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.60
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.85
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.54
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.41
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.96
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.79
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.39
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.95
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.68
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.90
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.67
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.16
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.29
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.32
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.47
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.65
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.37
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.94
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.49
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.05
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.40
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.55
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.84
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.40
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.80
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.94
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.77
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.21
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.19
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.53
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.49
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.98
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.79
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.54
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.33
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.81
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.80
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.71
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.52
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.74
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.19
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.70
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.55
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.33
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.68
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.41
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.05
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.78
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.39
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.79
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.17
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.91
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.76
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.81
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.14
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.16
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.80
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.30
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.44
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.32
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.17
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.48
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.30
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.63
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.14
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.73
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.84
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.92
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.69
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.30
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.29
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.30
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.86
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.78
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.95
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.27

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.