Gene detail

Detailed information of OS493_024616-T1 in Lophelia pertusa

Genomic Location: scaffold_116:135204...172500
NR annotation: KAJ7383931.1, Intersectin 1 (SH3 domain protein) [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_024616-T1

ATGTCATCACAAATGGCCTCTTCTCCTGCAGCTGGCGGGATTGGTCCTTCTCTTCCAGTATCATGGGTGATAACAACTGACGATCGAACCAAACATGAAGCGACCTTCCAAAGCTTGAATCCTGCGAGTGGTTTCTTGACAGGAGAGCAAGCTAAGAAGTACTTCCTGAAATCCAATCTTCCACCAATGGTGTTAGGTCAGATATGGAACCTTGCAGACATTGACCGAGATGGCAAAATGACCATGCAAGAATTCACCATCGCTGTTCATCTGATACAAAGCAAGCTGAAAGGAGTTGAGTTACCAACGTCGCTCCCTAACAGTTTGAAAATGACCTCTATGCCAAGTACCTTTCATGTGGGTCAGAAAACAAAACCAGCAGCCGACTGGGGTCAGCCAACAAACCAAGCAGTGTCAAATGGCTTCTCTCAGGTTGGCATGATGACATTGCCGCACAAAACTGTCACTTCAGGTATTTCATGGTCAGGAATAAAACAATCTCCGCCACAAACAAGAGCAGTGGCTTCATCTTCATCGTCGGTTTTTGGGTCATCATTTGGACCCAGTCTTCCTCCAGCTTCTTTATCATCATCATTCAATGTTGGAATGAGCAGTGGTTTAAACACTGTAGCATCAAGCACAGCAATTCTCAATGGACCAGGAAATCAAGCACAAACTGGTTTTGGGCCTGCTCCGCCTAATGTCCATAGGGCTAATTCACTGACTGGTAGTTTTGGTTCAAATGCAGGACCTTTTGGAATTATTAGTCCCACTAATAGATTGAAATATAATCAAATGTTCAAAGCAAATGATTACCAAAAGATGGGATTTTTATCAGGTGATCAAGCCAGAAGTATGTTGATTCAGTCAGGTCTTCCACAAGGAATCTTAGCTCAAATATGGAACCTTTCGGATTTGGACAATGATGGCCAGCTTAACATCGAAGAATTTGCCCTGGCCATGCACTTTGTTGATCTAGCAAAGCACGGCCAGACTTTGCCTCCAGCAGTTCCCCCGGAGCTTCTTCCACCTTCATTCCAGTCACGGCAAGTCAGCAGTACGTTTTCTCCAGTTCCAGACGGCCGTGAGAGGTCTGACAGTGGACGGGAAAGAAGTGGGAGTGAAAGGGAGAGAAGTGGAAGCATGTCAGATGGACGATCAAGATCTGGCAGTATGTCAAGTGGGAAAGGAGTTTTTACCTTTGAAGACAAGAGGAAAGACAACTTTGAAAAAGGTCGCTTGGAGCTTGAACGGAGACGCATGGAGTTGCAAGAAAAATTGAAAAGAGAGAGGGATGATCGAGAGAGGAAAGAACTTCTAGAGGAAGAGAGAAGACAAAGAGCAAAACTTGAAGCTGAGCAAAAACGACAAGCAGAGCTGGAGAAGCAACGCCAACAACAGCTAGAGATGGAGAGGGAGCAAGAAGCATTGAGGAAGAAAATGATTCAACAGCGACTTGCTGCCCAAATCGAAGCAGAGAGACAACGCCAGCTGGAGTGGGAAAAGAGAAAAAAGGAAGAGCTATTAAATCACAAAAATATGGAGCAAGATATTGTTAACAATCTTAAATCAAGGGTTCAGAAACTCGAAGAAGAATTAATTAAAGTGAACCAGTCTAGAAATGAAGCTCAAGAGACATTAGATAAAGAAAGGCAAACTTGTATGCAGTGTCAGTCATCACTAAACCTTATAAATCAGAGTCGAGAAATGAGATTAGCAGAGATCAGTAGAGTACAGTGTGATATCAAGGATTCGCAGCAAAGAATAGTCGTAATGAAGAAAGAAAGCGAGCGACTCTCTCAAGACATTAATCAAAGAGATACTAACATATTAGGAGACACCCATGGTAATGTCATGGCCAGTGTTCAAGACTCAAGAGGAAACCTTAGAAGACTACAAACATTGCAGAACAACATGGAGAGAGTTCTAGCTGAGAAGTTCAAGGAGCTGGACACCATGAATACACAGGTTAAGGACCTGAATACAAGTGTCCAGCAATTGCATGGCCAAAATACCAGGTTACAACAAATCTCAGAAGCAAAGCAGAGAGAGTATGCCACTTGGAAACAACGAAAAGATGAGGATGAAAGACAAAGGAAAGACAATGAGGCCAGACGGAAACAAGAAGAGGATGAAGTAAGGAAACAGAGAGAAAGAGAGTTGGAAGCCATGCGCCAAGAACAGGACAAACAGAGAAAAGAACAGGAGATGCGCAGGCGCCTCAATGAAGCAAAACAAGCTGAAGAAGCTAGACGACAGGAGGAATTAAAGAAACAACAGCTTATAACAAAAGACCAGATACTGGTACAACAACAGCAGATGTTGGTCTCAAGTAGTGTGCCGATTGTACGACATATCAGCAGTGAACAGACCAGTGTCACTAGCACGTCTGGCAGTGATGTGAAACAGAAGGTCTTACAGATGCAGCAATTGATAAAGGAGCAAGTGACAGATGTTATAAAACCAACCCCCACAAATGTCTTTAAACCAGTGGCCAAGCCAATCACAAAGAAGGAATACCACAAAGTGCTGTATGAATTTGAACCTAGAAATCCTGACGAGATGGCACTTGAAGAGGGGGATATTGTTTTGATTGACCCAGAGGCTAAAAAAGCTCCACCTGGCTGGCTTCTTGGCGAGTTAAACAACAAAAAAGGCTTGTTCCCAGCAAACTATGTGGAAAAAATGACAGAGGAAGAAGCAAAATCTGAAAAAGATGGCATGAGTGTTTCACCTGTAGACAGCTCCTCTGCAGTAAAGTCTCTCGCTGCAGCTCTCAGTATGCAGTTTGGCTCTGGTGCCAGCTCAATCAGTCCAACTGTAGTTGTCAACAAGAATTCTTCTCTTACAAACACAAATGTCTCCACAGTGTCCCCTAAACCTTCTAACAGCCAGCAATCGACTGAAGGGTTCAGAGTCATGGCTCTGTATCCTTACAGAGCTAAGAAAGACAACCATCTTACATTCAGTAAGAATGATGTGATCATCGTGAAAGAGCAGCGGGACATGTGGTGGTCTGGAGAACTCAATGGCAATGTAGGATGGTTTCCTAAGTCTTATGTTAAACTTCTTGGTGGAGTTAGTGGAACTGCCAAACCTACAGAGACAAATGGCACAGCTAAAGAGCAGGTGCCAAGCAAGGCTTCTGCACCCATTCCTCCTCCTCCAGAACCAAAGCCAAGTACAGCAGCAGCAGCAGCAGCAACCCTGTTTGAGTGTATAGCGCTATATAATTACACTGGTGAAGCTGGGGACCTGAGCTTTTCAGAAGGTGATGTCATCAATGTTCACAAAGATGAAGGCGAGTGGTGGGAAGGAAGCTGCAGCCTGGGGGAGAAGGGTCTGTTTCCTGCAAACTATGTCAAGAGGAAGGATACAGAGGTACCAAAAGCTGCCCCTCGAACAAAGCCAGAAATCGCCACCGTGACCACAGCTTATAATGCACTGTCAGCAGAACAGTTGTCTCTCTCACCTGGTCAGTTGATCTTGGTAAAAAGAAAGCATCCTGATGGCTGGTGGGAAGGAGAGTTACAGGCCCGTGGTAAGAAGCGTCAGAGCGGCTTGTTTCCGGGGAATCACGTGAAAATCCTGGACAGAAAAGCTCCGTCACCAGCCTCTCCCGTCACAGAAGATGTGTATAGTGTTCCTCCTTCATTGCCAAGAGCCAAACTGGAGCAGGTATTAGCCATGTTCCCGTACACCGCGCAGAACGCGGACGAGCTCACCTTCTACAAGGGAAGCGTCATAAACGTCGTAAGCAAGGAAGGGGATTGGTGGAAAGGCGAAATGAACGGCCAGACGGGCATGTTCCCGTCCAATTACGTTCAACCTCTTAGCAACTTGCAAGTTGGAACGACCCAATGGACGGGATCGTTTGATGCAAAGGTTTTAGCGTCAATGTCAACAACGGAGAGGCAAAGACAGAACGTTATATACGAGGTGATCAACACAGAGCAAACATATATGGACGATCTCAGTTTGACATTGGAAGTGTTCTACAATCCTCTGGCGGAGTCTGGTATGCTAACTGAACAGGAACTCAGTACTGTGTTTATCAACTGGAAAGAGCTGATCTGGTGCAACATGAGACTGCTCAAGGCTTTTCTGATTCGTAAGAAGATGAGCAGCAGTGTGGCTATTACTATGATTGGCGACATCCTCTGTGAAATGTTGCCCCGTCTAACACCGTACGTCAGATTCTGTAGCTGCCAGTTAAAGGCTTGTCAGTTGATACAACACAAGATTGAAAACGAACCCAGACTTCAAACAACTAGAGAAGAACTGTGTCGCGGATCCGAGAGCGAAGGGTCTTCCTTTGAAATCAATTTAGAAACTGCACTAGAAAAAGCTGAAGACCTTTGCCAACAGGTAAATGAAGGTGTTCGAAATCAAGAAAACACTGATCGCCTGGAATGGCTTCAAACACATGTGAACCTAGAAAGTATTGGAGAGCGTTTGTTTTTCAACTCCACAACAAACTGCCTGGGGCCACGAAAACTCTTACACTCCGGAACACTTTGGAAGGTCAAGAGTGGCAAGGAGCTCAAAGCTTTTCTGTTCAATGATTTCCTTATGTTAACCCGACCGCGAAGCTCCATTACCGGAAGTCTGTCAAAGAAGATTGGATTCGAGTCCAATGAACAAGACGTCATATATGACATTTACAGAAAGCCGATCATTCTTAATGACGTTATTGTGAAGAGAAGCCAGGAGGATAACACCGAGGAATATGTGTTCCATTTATCGCTTGCCGATCAGACTTTTAATTCCTTTCGAGCAGAATTGAAATCCGAAAGAAATCGATGGATGGATTTGATTGAGAAAGCATCACATACATACATTGAAACCGAGCGTGAATCAAGACAGAAGGCTTACAGAGCGCGATCTTTCCGGACCAATGGAATAGGGAAACTAAACGTCACTTTGATCGAGGGTGTTGACTTGATAGCTTCAGATCCAAATGGCTTCAGTGATCCTTTTTGTGAAGTGAGCATGGGCAGTCAAGAACAACGCACGAAAACTATACCGCAGACGCTTAACCCTAAATGGAGTTCTACGATGAGTTTTCATAGTTAA

Transcript

OS493_024616-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9WVE9	Intersectin-1 OS=Rattus norvegicus OX=10116 GN=Itsn1 PE=1 SV=2
O42287	Intersectin-1 OS=Xenopus laevis OX=8355 GN=itsn1 PE=1 SV=2
Q9Z0R4	Intersectin-1 OS=Mus musculus OX=10090 GN=Itsn1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002086 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16652 all species →	PH_13	Pleckstrin homology domain	Domain	Interproscan
PF14604 all species →	SH3_9	Variant SH3 domain	Domain	Interproscan
PF00621 all species →	RhoGEF	RhoGEF domain	Domain	Interproscan
PF12763 all species →	EF-hand_4	Cytoskeletal-regulatory complex EF hand	Family	Interproscan
PF00168 all species →	C2	C2 domain	Domain	Interproscan
PF00018 all species →	SH3_1	SH3 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000261 all species →	Domain	EH domain	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR035899 all species →	Homologous_superfamily	Dbl homology (DH) domain superfamily	Interproscan
IPR000219 all species →	Domain	Dbl homology (DH) domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR051480 all species →	Family	Endocytic & GEF Adapter	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46006 all species →	RHO GUANINE NUCLEOTIDE EXCHANGE FACTOR AT 64C, ISOFORM A	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0035025 all species →	Biological Process	positive regulation of Rho protein signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20045	ITSN; intersectin	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_024616-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

64.5Max TPM

36.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	43.69	64.50
polyp at pH7 6	18	18	43.73	60.22
coral polyp · control treatment	16	16	39.80	62.74
coral polyp · oil and dispersant treatment	16	16	34.54	48.25
coral polyp · oil treatment	16	16	39.00	58.20
coral polyp · dispersant treatment	16	16	24.50	42.00
Polyp	10	10	28.13	53.21

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	64.50
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	62.45
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.81
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.56
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.86
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.90
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.70
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.52
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.25
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.03
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.58
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.88
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.99
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.98
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.71
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.64
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.63
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.22
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.17
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.41
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.30
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.40
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.44
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.42
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.96
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.86
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.28
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.53
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.01
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.12
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.49
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.25
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.99
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.97
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.27
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.74
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.08
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.53
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.27
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.72
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.15
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.48
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.38
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.11
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.38
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.96
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.22
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.86
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.74
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.93
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.25
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.49
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.87
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.57
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.30
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.02
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.12
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.78
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.47
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.44
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.89
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.04
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.87
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.49
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.22
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.83
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.20
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.88
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.97
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.33
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.70
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.58
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.67
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.68
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.65
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.73
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.90
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.23
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.95
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.11
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.92
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.53
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.00
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.76
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.25
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.10
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.83
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.33
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.45
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.64
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.01
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.68
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.92
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.67
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.61
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.84
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	53.21
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	43.19
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	39.14
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	37.17
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	36.97
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	20.46
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	18.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	12.04
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	11.33
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.71

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.