Gene detail

Detailed information of OS493_024617-T1 in Lophelia pertusa

Genomic Location: scaffold_116:173046...192157
NR annotation: KAJ7383932.1, listerin E3 ubiquitin protein ligase 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_024617-T1

ATGGGTGGAAAAGATAAACAAAGAACTAAAGGAAACGTAAAGCCATCTAGCAGTGGTCGCGCAGCAGCGTTGATTTCTAAGGATGGTACTGTGGGCTTTGTTGGTTTTGGAGGCCTGCAGGGAAGTCCAGGAGCAAGTAACCTTGGTTACGTTCCAATGACTGCTGGTGTCGGTGAGGATGTTGACGCTTCTGTTGACGCAGAATTCAGGATGGTGATGAGGAAACTCATGAAGAGAGACTCTGTTACAAAATTGAAAGCAGTGCAAGAGTTCACGGACTTATGTAAGAATTCAACTGTCGATGCTGTGGAAAGTGCACTTCCATTTTGGCCGAGGCTTTTCAACAAATTGGCTATGGATATTGATCACAGAGTGCGAGAAGCCACTCAGCAAGCCATGGAGCAGCTGGTTCTCAGAGTCGGTCGTAATCTTGCACCACATCTGCGTTACATCATTGGTCCTTGGTTATGCTCACAATTTGATACATATGCAGTGGTGGCATCGTCAGGAAAGAAGTCTTTCAAGACAGCATTCTCAGAAGAAAAGCAAATTGAAGTCATCATGTTTTGTAGAAAGGAGTTGTTTGAGTTTTTACAGGACAACATATTATCACAAACACCTTCAACCCTCTCTGATCCAAAATTTGTGTCAGAAGAGGAAATGGAAGCCAAGTATAACCGAGTTCTTTCATCCTCCATCTTGGGCCTTGGACAACTAATACATGTGACATCCAGCAACGCTGATGCAGACATGGAAGAGCTTTTTCTCGATGTACTGCGGCAGAACAAGTTTTGGAAGTATGCCAGGCACAAATCTCCAAATGTACGGGGTGCAGTGTTCTCCATGGTTAGCGTCACCTGTGAGATACTCCCCTCTATGATGTTATCCCTTAGCTCCCAGGTCTCCCCGGCTGTGTTGTCGGCACTGGATGATTCTGATCCTGCTGTTTGTCAACAGCTGTGGAATGTTGTTTTATCTGTGCTAAAGAATATCACGGACTGTTGGAAGCAAGTTAATGTCCGCAAAGCTGTTTTGCCAAAATTGTGGTCTGTCTTAAAAAATGGCGGCAGTGGTTGTGCTAGCATCATCTTTCCTAACTTGCTTCCTTTCTTAAGCAAAGTACCTTCAGAGGTAATTGGCAGTGGTGTAGGTTTCTACCAAGAATTCTTTATTAGTCTTCAAGAAGGCCTGACGAAGGAACGTGTGCTGAACAGCCCTAGTGAATGTTCGGCAGTGATTGCAGCATTTATGGAGTGTCTGAGATTTTGTCTTCTACGTGACAGTGATAGTGATGGGCCAGATGTCGCTGTGCAAGAATATCTGATAAAGGAACAGCTACTCTCAGTGTTGAAAATATCTTTGGAAAAGCAAAGTAAACTGCTGCAGTCCAATCTTTATCCTCTTGTTGCTGACCTGCTGTCTTATCTGTCAATCAAATCGGAAACTGATCCCAAATCAGATGAGGAAGTGGAAGAGCAGAAATTGACGCAAAGATTTTGCCACATCCTCAAATGGTTCTGGGAAGGCTTCAGTTTTGTCTGCCTGGAAAATCTGAACTCAGTTGTTGGACAAGTGGTTGGAGATGATGTCGTAAATTCTGTGTCACATTGTTTGGTTACTCTAAAATGCCCATCTAACAAGAAGAAAAGGCAACAGAAGGTTGCATTTACAGAAATGTCTTCTTCTGCACAGTTTGGCAATGATTCATGTGAGAGTAGAAAATGTCACCCTTCGAGTGAGTCGTTGACTGCAGGCTCTGTGGAAACACTTTACAATGGATGTCTTTTGCATTTGGTTTGCAACATTTGTTCTTTGTGCCTGAACGAAATTTCTCAAAATAATTCTCTGTCACATTTGAAGCTTCTCTCTTGCGTTGTTCCTCACTTCACATCAACAAAACTTATCAAAACATTGTTAAAGAACACCAGTGAACAATCTTCAACACCAGCTGGCAGTGATAGTTACTCTTTGTTAACTGGACAGTTTGTAAATCACACTTTATTCCCTTGGATCAAGTCATGTCACGAACAGTCTCTCTCTGGTCATGACATTGGGAATGTGAGTGGTGTTTTCACAGACAACAGATCTGTTGATTATATCATCGCCATTTTCTGCGGCATCATAAGAACATTACCATTTGTGAAACAAGTGGAGTTAGTATCAGAATCCCTCCAGCAACATACAGCCATCAGCTTCTTGTACAAAGTCCTTGAGAAGGGACTCCATTCAGAAGTTCCTGGTGTAGTCAGATGGCTTCAAAGCAAAGATGGGAGTGAAAAGCTCCTTGAGTTGTCAAGGTGTTTGGTTGTTCATTTTGGACAAGACACAGCTCTTTCTGAAGAAGATCGGATGTCTGTCTGGAAACTCCTAAAGTTATGCATTGTGACCGAAAGAAATGTTGCGATGCTGGAAAATGAACTTGTAGACAAGATTTGTCAGCATTTCCTCAGGATTCTTAGACAGTCTGAGCAGGAAAATGAACAACAATTGTTGCTGTTGCTGAACATTTTACGGATGTCTCTTGCTCATTGCGAAAATAATGCTGGTGATATTGTGCACTCTACAGAGGAACTTCTTTTAGCTGTCTTTCAACTACAGTTGGCCGACACAGTCTCTTCTCCTACTGTATCACAGTCCTTGGCAGAAACATGGCGAACTGGATTAAAGGTGTTCAGGCAATTTCCCTCGGATGTGGATTCTACTCCGTGTCAGGCACTTCTACTTAAAACAGCCGTGCTCATTCAAGAGAAGTTGGTGAAAGTCGAAACACTCGAGAGATTGGATAACCTTGCCAGTATAGCTGTCTGTCTTCTAAAGGATGCAAGTCACTTGTCATCTGCTGAAGAACTGAAAGACGAGTCCTTATCACAGAGAGTGTTTACGGCCTTGACACCAAGTGGACAGCAGTTGAATTTTCTCAGGAACGAATATCCCATGAGTCAGTGGCTATTAGCTCCTCTGTTAGAGAGAAGATTGCCAGTCATGTCAGACGCTCATGACCAGCTCGACGAATGTCCACGGTCCACTCTCACGAACCATCACAAAATGATCGTGTTTTCGTCGACTCTAGTCAAGGAGATGCTCTCAGATGCTAATGAATCATCAGTCGTAACAAGGGATTGTTTCATCCGCTTGTGGTTAGAGACGAGCTGGGTTCGACACTGGTGCACTTGTGTTTTGGGATGCAGTGACGTCACAGAGGAATTTACCGCGTACAGCAACAATTCTGACCAAACCGTCTTCAATCTTCTGATGAAACTCCGACAGACAAGTGATCACCTCCTTGAACACATTAGAGAAAAACATTGGAGTGAAGCTCTTCTCGCATTTGCACTTACGCGTTCAAGAAGCGAAGGTTTCTTGTGGTGCCTCGTGCTTGGAAGCGTGTTAAAAGACCTGCAGCTGCTGGGTGTGCCTTACGAAGCTGATTTTATGTTGACTGAGGTCCAATCTTTTGCTTCTCTTGAAGAAAAGGAATGCCAGACTCTTACTACTTTGATAGCTCATGTGGATGGAATCTACGAGCTGAAAGTCATTACTGAGCAATATACTAGACTGTTGCGTGAAGAGAACGATGAAAGTGCATTTGCCCGCGTGTTTGCTGTCATTGATGGCTCTCTTCATCAGTGGTTTAAACAAACCAAAGGCGTGGAGGAGGCACTGCTCGAGTATCAGCTGACAATAACAGAGATTCTGGACGAGCTTGTGGAGTGGAACAAGATACACGACAACCTTTTGCTGATGAACAGCTCTTTGGACGATGCTTCTATGAGCGTTTTGACTATAAACATGTCGCTTATCAGGACCCTAGAGATGGCTGTTCTACATTGTCCTGACAAGATGAACAGCAAGCACTGGGATTTTATGCTTTGTAGTTTGGCCGGTTGGCTGCAGACCTGTGAGGAAAATCGCTCAATCCTAACATCGTTGAAATGTGTCGCTGTCTGCTGCCAAGTTTCTTCGCTCTTTTGCACCGTAGCGCGGTTCTTTGAGGAGAATGCTTCAAAACTCTCCAAGATCAGTGACGATGGACTCTCCAGTGAGACATCACATGAAGTAGAGAGCGGATCTTCACTAACTGTTGACACTGCAGAGTTTCCTCCAAATCTGTTCGCTGAATGGCAGGAGTTCTTTAGTGGAACTCTGTTCAATACAGTGTTGCAGTTGTTCCTCTTCCATTCAGCCCAGTGTCAAAGCGCCCATTTTGAGGCATCACTGTGGTCGAACCGCATCAGTGAGTCACTTGGTTCGGCTGTAATCTACACTCCCACGCCCCTCCTAAAGGAGCATAAGTTTGAGGGACCGCCACATGCTACCGCTAAAGAATCCTCAAATATGCCCCAGTGGATAGGTGACCTCCTGGAGCACTGCTTGCCTCTTCTGAGTCTGCATGGTCTTCAGTTTGCTACTTATCATCTGCTTTCCAAAGTAATGTCAGAGAACACGTTTTTAGATGAGCAGGAGCCTGAGTCCGAGCAAAGAGGAGACGAGCCAATCAGATCCCCACCCACCCCACTCATATCGTTAATAAACACCACATGCGCACACATGACTGAGATGGTGAGTGATGCGCATGTGCCGTTTGGAGAGCACCTGGATATGACTAGTGACACAGAGGCCCAGAACGTTAGCCTCGCTCTCATGTTAGCCTGGAAACTTCTGCTTCAGTTCTTTAGAAACTTGCCGCAAGAAAGGCGAGTCGAATACGCCAAGTACATCAGACAAAACAAGATGGTGGCTAGTCTTCTCGGTGTGCTGTTTCGACTGATTCCGCTCAAACCAGCAGCATTGGCAACAGCAATGGTAGCAGATGACTTTGAGCCGCAGATCGGACGTTTTTCTGGTCAGCGTACTATCCAGCAGCTAGCATGCGGCGTGTATTATTCGTTGACGCAGTGGATGCCGGCTATTGTCAGGCAGTGGTGGAATGGCTTGGATAAGCGCCAGTCTGCAATAGTGGACAAATTCACGACTTCCAGTATCACACCTCAGTTGTGCCAGCGAGAAATGCAACTGGTTCAAAGCTCTTCAATCCGGTTTGACAACATGCAAGTCAAGACTCGGCCCAGTGCCCGAGAGGTTGCCGCGGTGTACACGGTCGACGAGATCTCTATGGAGCTGGTGGTGAAACTGGCGCCAAACCACCCGCTGGGGTGGTGTCAGTCGAGAGTGGCAAGAAGATCGGTGTGA

Transcript

OS493_024617-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6A009	E3 ubiquitin-protein ligase listerin OS=Mus musculus OX=10090 GN=Ltn1 PE=1 SV=3
O94822	E3 ubiquitin-protein ligase listerin OS=Homo sapiens OX=9606 GN=LTN1 PE=1 SV=6
A0JM49	E3 ubiquitin-protein ligase listerin OS=Xenopus tropicalis OX=8364 GN=ltn1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003807 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_024617-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR039795 all species →	Family	E3 ubiquitin-protein ligase listerin	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12389 all species →	ZINC FINGER PROTEIN 294	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0043023 all species →	Molecular Function	ribosomal large subunit binding	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan
GO:0072344 all species →	Biological Process	rescue of stalled ribosome	Interproscan
GO:1990112 all species →	Cellular Component	RQC complex	Interproscan
GO:1990116 all species →	Biological Process	ribosome-associated ubiquitin-dependent protein catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_024617-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_024617-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

31.2Max TPM

14.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.30	16.59
polyp at pH7 6	18	18	11.53	16.37
coral polyp · control treatment	16	16	17.03	29.88
coral polyp · oil and dispersant treatment	16	16	16.89	23.41
coral polyp · oil treatment	16	16	16.44	31.17
coral polyp · dispersant treatment	16	16	12.81	24.77
Polyp	10	10	14.95	28.22

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.59
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.12
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.01
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.54
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.53
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.31
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.94
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.82
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.03
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.86
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.72
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.61
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.09
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.24
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.92
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.73
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.54
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.37
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.06
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.03
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.29
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.84
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.45
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.89
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.43
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.17
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.16
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.52
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.87
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.03
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.15
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.76
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.73
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.88
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.23
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.56
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.39
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.34
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.59
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.74
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.22
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.59
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.91
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.25
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.20
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.37
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.11
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.58
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.41
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.27
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.52
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.41
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.74
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.46
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.61
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.06
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.68
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.67
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.74
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.27
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.37
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.21
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.76
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.92
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.62
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.40
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.18
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.23
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.55
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.21
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.59
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.01
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.95
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.43
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.16
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.77
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.68
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.52
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.19
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.75
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.58
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.33
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.10
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.57
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.24
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.61
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.51
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.40
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.03
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	28.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	26.15
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	24.33
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	19.45
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.55
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.65
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.59
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.27
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.14

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.