Gene detail

Detailed information of OS493_024626-T1 in Lophelia pertusa

Genomic Location: scaffold_116:275496...287129
NR annotation: KAJ7383941.1, Endoribonuclease Dicer [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_024626-T1

ATGGACGAGGAGGAAAGCGAGATAGCCACCGAAAGCGAAACAGAAGACCAGGAACCGGAAGACAGCAGACTCACCGCTCGGCCGTACCAAGTCGAGTTGTTAGAACGAGCCAAGAAGAGGAATACGATAGTATGTCTGGGCACGGGAACTGGCAAGACGTTTATCAGCGTCATGCTAATAAAGGAACTCGCTCACGAAGTGAGAGAAACCTACAAAAACGGCGGAAAAAGGACCTTCTTCCTCGTAAATACAGTCCCTTTAGCCAGCCAGCAAGCCAAAGTGATTGGGGACCACACAGACTTGGAGGTGAAGCATTATGTTGGCGAGATGGGAGTGGATTTCTGGAACGAATCTGTCTGGGAAAAAGAGTTCAATGAGTTTAATGTTCTAGTCATGACAGCACAGATATTTCTCGACCTATTGGGCCATGCTTACATCCGTCTATCCCAAGTGAATCTCCTGATCTTTGATGAATGCCACCATGCCAAGAAGAATGATCCTTACAAGCAGATAATGCAGTTCTTTGATCGTTGCCCTAAACATGCATTTCCAAGGTCAACATGTGAAACAAGTCAGGATGGGGACGTTGAGAAGTTCGCTGCTAAACCCAAGGAAGAGGTTTTAGTTTTCTCAAATGAGAACATCGACGATGATACAAACATCTTGATTCGAATCCTAACAGATGTTTTAACACCAGGAATTGATTTTCTTTCTGACTGCCGGGTGTCCAGCAGAAACGAATCAGTGAAGAATGCACATTGGTTTGCAAAGTTTGCCCTGAGGGAGTGCCAGGGCACCTTAGACGAACTGGGCCCTTGGGCTGCATACAGAGTAGCAGGATACCTGATCAAGGACTTAGACAGAGCATGCATGTTTCAAGATAGCCGAGAGGGACGGTTGTTTTGCGAGTTTTGTGCCACCCAGCTGCGTCAGCTACAAGGTGTCTACCGCAATTTTACATCTACCTCCAGTGATGGCTCAGATGAAAATGGACAATGTCATATCATGCCCAAGCTTCAGAAGCTTTTAAGTATTTTAAAGACATTCCGCAGTTCACAATCTGAATCCGATGGAGAGAACAAGCTCTGTGGCATCGTGTTTGTGGAAAGAAGATACACAGCTCTGGTCCTCAGTGAACAGATCAACATCGCTGCCAAACTAGATCATGAGCTAACCTTCATCAAAAGCAATTTTGTGATTGGTCACGGAACAGGCGGAAAGGTTAACTACTCCAGTCATACAGAGATGAACTTCAAGAAACAGGAAGAAATGCTAAAGCGGTTTAGAAAACGTGAATTCAACCTGTTGATAGCCACTTGTGTTGTCGAGGAGGGACTAGATATTCCAAAGTGTAATGTAGTTTGCCGGTTTGATTTCCCGAAGAGTTTCCGTTCCTATGTTCAGTCAAAAGGCAGAGCCCGTGCAAAAGATTCCAGATACTATATGCTAGTAGCGAAAGAGTTGAAGGGGGAAGCAGAGGGTGAATTGGAGCTGTTGCGTGCGATTGAGGAAATCTTGTTGAGTATGTGCCATGATCGGGTCGAACCAACAGAGGAAGAGTGTAGCGAGGCAGTCGACACAGACTTCTTATCTCCGTACATACCTGTGACAGGACGAGGAGCCAGGGTTACTATGAGCAGCAGCATCTCTCTCTTATCCAGATATTGTTCCAAGCTTCCTGGAGACCGGTTTACTCGTCCCAAGCCTGTTTACACGGTCGAGGAAATTGGACTTAATTCGTACAAGTGTAAGCTTGAATTGCCAATAAACTGCCAACTGCGTGAAGACATCTTGAGTCCTCCCATGCCAAGAAAGAACCTCGCAAAGATGGCCGCCGCACTGTATGCCTGTGAAGACCTTCACACGATTGGCGAGCTTAATGATGACCTGTTGCCTGTGTGCACGTTATCTGATGAGGAAAGTGAGTCGGAGGAAGAAGAAGAGGCTGAATCTGGTGGAAAGAAAAGGAAAGCAGGAACAAAGAAACGACAACGACGCTATGACAAAAAGGTCCCTGACGTCTTCACTGGCAGCTTAGTGCAGGATGGTCAGCCCCAGTTCCTCACGACTATCACCATACGCATCACCAAACTCACCAGGCCTCAGGAGCTTGTTGTGAGATCTTTCAAACTGTATCCTGACTATGGAGAAGTCATCGTATCGCTGACATGTCACCGATATCCTCTTCATATAAACAACACCAAGCAACACTTGGCCATTGTCCGCCAGTTTCACTGCTTCCTGTTCAGTCAGGTTCTGCGCATGCCCGTAGAAATAAAACCCGAAAGCGCCGATGGTTACTTCATCGTTCTGGTCAAGACTACCGGAAATGACGTGGACTTTGATCGCATGCGAGAAGAGTTACGCTTAGAGACCTCCCTGGTGCACCTAAGCAAGCAACCCCGAGGGCATGCTCCAATTGAAGAAGACGCGGTGGTTAAAAAGAATTACGACATTGGTTCGCGACAAAGGTATGCTGTTTTATCTGTGCGTCACGATCTCACACCATTGTCATGCTTCCCGGACAGCTCCAAAGCCAAAACGTACGAACAGTATTTCCGGCAGAGGTACGGAGCATGCGTCACGGACAAGAAACAGCCTCTCTTCGAAGTTAAAGAGTTTTCTGGGAGAGTCAATTTCTTGGTGAACAGAAAGCCGGAAGCCAAAAACAAGCGTGATGTGATTTGCCTTGTTCCAGAGCTGTGTAACATCTCGCTGCCTGTTCGCGCATCGCTTCTTTGTGTGTCTCAGATGCTGCCATCAATCCTACAGCGCGTCAACTCACTGCTGCTCGTTGCCGATGTCAAGGCCATGATTGCTGCTGGTGTGCGCGATGTCACGGATGAATCAAGACTCCCTTCCATTGGAGCCGATGATGCTAATAGTGAAAAGAAGTTACTCGACACTAGTAACCGACGCAGTAAAACAGAAGAGGCGCCTATGGAAGGTGACGCGACGACGATGATGATGATGATGACGATGATTCAGATCTAG

Transcript

OS493_024626-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6TUI4	Endoribonuclease Dicer OS=Bos taurus OX=9913 GN=DICER1 PE=2 SV=3
A0MQH0	Endoribonuclease Dicer OS=Cricetulus griseus OX=10029 GN=DICER1 PE=2 SV=3
Q8R418	Endoribonuclease Dicer OS=Mus musculus OX=10090 GN=Dicer1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001530 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03368 all species →	Dicer_dimer	Dicer dimerisation domain	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF02170 all species →	PAZ	PAZ domain	Domain	Interproscan
PF20930 all species →	Dicer_PBD	Dicer, partner-binding domain	Domain	Interproscan
PF04851 all species →	ResIII	Type III restriction enzyme, res subunit	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR005034 all species →	Domain	Dicer dimerisation domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR036085 all species →	Homologous_superfamily	PAZ domain superfamily	Interproscan
IPR038248 all species →	Homologous_superfamily	Dicer dimerisation domain superfamily	Interproscan
IPR003100 all species →	Domain	PAZ domain	Interproscan
IPR048513 all species →	Domain	Dicer, partner-binding domain	Interproscan
IPR006935 all species →	Domain	Helicase/UvrB, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14950 all species →	DICER-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016891 all species →	Molecular Function	RNA endonuclease activity, producing 5'-phosphomonoesters	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0004525 all species →	Molecular Function	ribonuclease III activity	Interproscan
GO:0004530 all species →	Molecular Function	deoxyribonuclease I activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006309 all species →	Biological Process	apoptotic DNA fragmentation	Interproscan
GO:0016442 all species →	Cellular Component	RISC complex	Interproscan
GO:0030422 all species →	Biological Process	siRNA processing	Interproscan
GO:0031054 all species →	Biological Process	pre-miRNA processing	Interproscan
GO:0090501 all species →	Biological Process	obsolete RNA phosphodiester bond hydrolysis	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_024626-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_024626-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

51.7Max TPM

18.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.94	21.50
polyp at pH7 6	18	18	12.52	23.28
coral polyp · control treatment	16	16	23.44	45.10
coral polyp · oil and dispersant treatment	16	16	26.19	51.71
coral polyp · oil treatment	16	16	17.21	29.54
coral polyp · dispersant treatment	16	16	23.26	45.91
Polyp	10	10	5.48	10.71

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.50
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.49
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.16
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.14
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.73
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.70
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.69
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.98
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.96
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.40
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.04
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.95
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.59
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.82
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.81
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.57
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.42
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.28
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.69
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.76
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.32
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.37
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.27
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.18
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.83
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.71
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.65
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.45
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.85
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.30
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.61
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.30
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.77
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.10
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.53
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.65
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.47
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.36
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.72
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.10
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.79
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.52
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.25
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.93
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.75
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.85
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.60
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.66
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.72
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.38
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.38
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.94
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.93
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.93
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.82
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.47
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.09
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.90
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.23
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.36
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.56
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.91
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.67
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.54
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.95
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.59
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.83
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.63
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.77
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.52
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.32
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.93
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.78
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.78
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.66
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.29
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.97
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.74
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.11
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.91
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.61
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.56
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.41
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.35
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.03
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.87
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.19
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.03
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.85
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.39
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.67
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.85
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.79
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.71
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.71
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.07
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.21
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.04
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.49
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.54
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.89
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.07
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.73
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.07

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.