Gene detail

Detailed information of OS493_024859-T1 in Lophelia pertusa

Genomic Location: scaffold_118:468717...482498
NR annotation: KAJ7371519.1, Elongation factor 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_024859-T1

ATGAGCAGGAACGCTGCATTACCATTAAATCAACAGCCATCTCTATGTACTATGAAACTGTCAGACGAAGATTTGCAATATATCGAGGGTGAACGAGAAGGCAAGGGCTTCTTGATTAACCTGATTGACTCGCCTGGACACGTGGATTTCTCATCAGAAGTTACAGCTGCTCTACGTGTAACTGATGGTGCTCTTGTTGTTGTAGACTGTGTTAGTGGTGTTTGTGTCCAGACTGAGACAGTGCTGCGGCAAGCAATTAATGAGCGTATCAAGCCTGTCCTTTTCATGAACAAAATGGATCGTGCACTTCTAGAACTTCAGTTGGAGAAGGAAGATCTGTACCAAACCCTCCAGCGTATTGTGGAGAGCATCAATGTCATTGTTGCGACTTACGCTGATGACGATGGTCCAATGGGAAATATACAGGTTTCTCCAGAGAAAGGAACTGTGGGTTTTGGTTCAGGTCTCCATGGCTGGGCTTTCACCCTAAAGCAGTTTGCAGAAATTTATAGCAAAAAGTTTAAGATCGAACCTGCTAAGCTGATGAAACGTCTATGGGGGGACCAGTTCTACAATCCCAAAACTAAGAAGTGGAACAAGACTGAGGGAGAAGGTTTTACACGTGGGTTTAACCAGTTTGTTTTGGACCCAATATACAAGATGTTTGATGCAATCATGAATTTCAAGAAAGAGGAAACGGCAAAACTGCACGAAAAGTTAGAAATTAAACTCACTAAAGAAGAGAAAGACATGGAAGGGAAACCACTGTTGAAGAGGACGATGCTGAAGTGGCTACCAGCTGGTGATGCCTTGCTTCAGATGATCACCATCCATCTGCCATCGCCTGTCACAGCTCAGAGGTACCGGATGGAGTTGCTTTATGAAGGACCTCTGGATGATCCTGTTGCCCTAGGAATTAAAAACTGTGACACCCAGGCTCCATTGTGTTTGTATGTCTCCAAGATGGTTCCGACTGTAGACAAAGGCCGCTTCCATGCCTTTGGGCGTGTGTTTTCAGGAAAAGTGGCAACAGGACAGAAAGTACGCATCATGGGCCCAAACTATGTACCAGGAAAGAAGGAGGATTTGTATAACAAATCCATTCAAAGGACTATTTTGATGATGGGACGCTACACTGAAGCCATTGAAGATGTTCCTTGTGGCAACATTGTGGGGCTTGTTGGAGTGGATCAGTTTTTGGTCAAGACGGGTACTATTACTACCTATGAAAATGCCCACAACTTAAAGATGATGAAGTTCTCTGTGTCGCCAGTGGTTCGTGTAGCTGTCGAAGCAAAGAACCCAGCTGATTTGCCTAAGCTGGTGGAAGGCCTGAAACGACTGGCTAAGTCTGATCCTATGGTACAGTGTTTAATTGAAGAAAGTGGAGAGCACATCGTGGCAGGAGCCGGGGAACTGCATTTGGAAATCTGTCTGAAAGATTTAGAAGAGGATCATGCTTGCATTCCTCTCAAGAAATCAGATCCAGTGGTGTCTTACCGTGAAACGGTTTCTGAAACATCCGCCTTCACGTGTCTTTCAAAGTCACCAAACAAGCACAACCGTCTGTTTATGACAGCAGCTCCTTTCGGAGATGGTCTAGCTGAAGATATAGACAGCGGAGATGTGTCTTCAAAGCAGGATTTTAAAGCTCGTGGCCGCTACCTGGTTGAGAAGTATGAATGGGATGCAACAGAATCACGTAAGATTTGGTGCTTTGGACCTGAGGGAACTGGTCCAAACATGGTGGTTGACTGTACTAAGGGAGTACAATATCTGAATGAAATCAAGGATAGTGTGGTAGCAGGATTCCAGTGGGCATCCAAAGAAGGTCCTCTCTGTGAAGAAAATGTGCGTGGTGCAAGGTTCAACATCCATGACGTCACCCTTCATGCTGATGCCATTCATCGAGGTGGTGGACAGATTATTCCAACTGCCCGTCGCTGCTTCTATGCCTGCATGTTGACTGCCAAGCCAGCTTTGATGGAACCAGTTTATTTGTGTGAAATCCAGTGTCCAGAGTCTGCAGTTGGAGGCATTTATGGAGTGCTGAACAGGAGACGAGGGCACGTTTTTGAAGAAGGCCAAGTAATAGGAACTCCCATGTTCCATGTTAAGTCATACCTGCCTGTAAATGAGTCCTTTGGTTTCACTGCAGATCTTCGATCCAACACTGGTGGCCAGGCCTTCCCTCAGTGCGTGTTTGACCACTGGCAGCTCATGCCAGGTGATGCCACAGATCCAACATCAAAGCCTGGACTAGTGGTGGTCGCGACACGGAAGAGGAAAAATCTTTCTGATGAATTACCACCTTTGGACAGGTTCCTTGATAAACTATAA

Transcript

OS493_024859-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0SXL6	Elongation factor 2 OS=Callithrix jacchus OX=9483 GN=EEF2 PE=2 SV=1
Q3SYU2	Elongation factor 2 OS=Bos taurus OX=9913 GN=EEF2 PE=2 SV=3
P13060	Eukaryotic translation elongation factor 2 OS=Drosophila melanogaster OX=7227 GN=eEF2 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001696 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00009 all species →	GTP_EFTU	Elongation factor Tu GTP binding domain	Domain	Interproscan
PF00679 all species →	EFG_C	Elongation factor G C-terminus	Domain	Interproscan
PF03144 all species →	GTP_EFTU_D2	Elongation factor Tu domain 2	Domain	Interproscan
PF03764 all species →	EFG_IV	Elongation factor G, domain IV	Domain	Interproscan
PF14492 all species →	EFG_III	Elongation Factor G, domain III	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR000795 all species →	Domain	Translational (tr)-type GTP-binding domain	Interproscan
IPR005517 all species →	Domain	Translation elongation factor EFG/EF2, domain IV	Interproscan
IPR000640 all species →	Domain	Elongation factor EFG, domain V-like	Interproscan
IPR035647 all species →	Homologous_superfamily	EF-G domain III/V-like	Interproscan
IPR004161 all species →	Domain	Translation elongation factor EFTu-like, domain 2	Interproscan
IPR009000 all species →	Homologous_superfamily	Translation protein, beta-barrel domain superfamily	Interproscan
IPR041095 all species →	Domain	Elongation Factor G, domain II	Interproscan
IPR020568 all species →	Homologous_superfamily	Ribosomal protein uS5 domain 2-type superfamily	Interproscan
IPR014721 all species →	Homologous_superfamily	Small ribosomal subunit protein uS5 domain 2-type fold, subgroup	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42908 all species →	TRANSLATION ELONGATION FACTOR-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003924 all species →	Molecular Function	GTPase activity	Interproscan
GO:0005525 all species →	Molecular Function	GTP binding	Interproscan
GO:0003746 all species →	Molecular Function	translation elongation factor activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006414 all species →	Biological Process	translational elongation	Interproscan
GO:0043022 all species →	Molecular Function	ribosome binding	Interproscan
GO:1990904 all species →	Cellular Component	ribonucleoprotein complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03234	EEF2; elongation factor 2	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_024859-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

2,793.2Max TPM

1,879.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1,904.38	2,148.89
polyp at pH7 6	18	18	2,125.71	2,578.77
coral polyp · control treatment	16	16	2,000.32	2,793.16
coral polyp · oil and dispersant treatment	16	16	1,925.21	2,496.91
coral polyp · oil treatment	16	16	1,957.53	2,542.26
coral polyp · dispersant treatment	16	16	1,558.72	2,021.24
Polyp	10	10	1,509.92	2,231.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2,148.89
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2,138.79
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2,048.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2,032.03
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2,026.33
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2,018.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,968.98
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,962.06
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,954.34
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,951.27
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,950.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,893.24
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,847.11
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,839.43
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,782.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,764.86
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,476.02
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1,475.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,578.77
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,559.06
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,420.26
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,398.56
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,382.98
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,318.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,090.37
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,076.95
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,017.91
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2,014.44
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,989.14
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,983.68
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,981.20
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,979.51
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,976.66
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,960.65
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,785.26
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1,749.11
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2,793.16
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2,498.90
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2,462.69
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2,353.84
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2,195.02
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2,143.37
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,995.68
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,953.09
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,937.56
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,933.98
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,699.85
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,690.69
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,666.24
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,568.29
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,557.33
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1,555.37
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2,496.91
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2,439.11
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2,242.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2,071.35
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,956.76
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,955.12
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,942.77
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,931.26
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,924.17
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,910.12
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,850.51
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,832.19
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,744.95
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,686.36
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,422.27
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1,396.94
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2,542.26
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2,502.35
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2,155.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2,080.01
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2,063.18
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2,030.77
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2,010.36
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,975.93
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,959.63
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,906.02
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,881.04
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,751.86
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,715.99
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,656.90
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,623.64
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1,464.62
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2,021.24
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,878.91
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,864.11
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,802.36
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,651.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,597.38
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,561.77
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,548.14
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,546.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,475.83
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,458.07
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,447.85
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,428.05
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,279.81
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,261.23
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1,116.87
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2,231.62
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2,011.83
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1,721.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1,704.89
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1,542.94
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1,430.44
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1,287.27
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1,217.35
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1,093.25
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	858.47

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.