Gene detail

Detailed information of OS493_024988-T1 in Lophelia pertusa

Genomic Location: scaffold_119:715417...737001
NR annotation: KAJ7357472.1, WD repeat-containing protein 27 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_024988-T1

ATGGCGGCAACTCATGATGGTTTGCTGCGAGTTTCTTCATCTCCGGGCCAGTTACAAATGACCTGCACAAGCGATTTCCTCGCATTGCCTTTAACAAAAACTATTGTAGGTGTTTGGTGGCTTGGAGACTTGTCGAGAAAGCCCTTGCAGTTATCTGGTCACAGCAGAATTATAAGTGCAACCTGTTTTGGACAAAAGGACAGACCCCTTCTTCTCTGCACAGCCTCAGAAGACTTTATTTATATCTGGAATATCAACAAGCTTTTGGCTATTGACAACTTAACTAGCGATCATAGCAGTGGCATACCTGTTGGGAAAGACCTGGGGCACATCCAGCACCTTAGCTTTAGCCTGACAGACAGGCTGATCACAGCGTGCATTGGAAAAGAAATATGGGTCCTGAATATCCAGACCAGTAAACTGGACACCCTGCTGGAAGGACACACCAGTCATGTGACATGTGCACAGTTTAGCCCCAACAATGGGTCCATCATTGTATCCACAAGTGAAGACAGAACTTTTAAGGTGTGGGATATTAAGCAGTCCTGTCTGTTGTACCAGTCAGCTATTTTGTCAGCCCATCCATTCCTATCACTGGCTATTGATCCTGTTCAAGACCAAATGGCTATCGGCTCTGCCGATGGGAAGGTTCACATGTATGACCTGACTTATGAAGGCGGTTACCGATGCCTATTTGAATTGGATGTCGGTCAACTGCTGCAGAAATACTGGAATTGGAGAGAAACATCCAAGGCTACGTCAAACAATGGGCCATCCTTCATTAGCAGCCAGCCATCTTGGCAAAAGGAGAGCATACCTGATGATGAAAAGGAATCTACACTGGAGCCAGGAACAGCAGTGCTTGCTGTCTGTTTCATTAGGAATCCACAACAGCCGAGTGCTGAAGAGAATGATGCAGCAGGCTTACACAGGGTCCTGTTTGGGTCGCAGAGTGGATCAGCTATAAAGGATGTATTTCATGTTCCGTCCATTGTCGCCATAGCAACAACAGCTGCTGTTCTTCTGTTAAACTGTAACAGTCGAGAGCCACTTTATATTCTGGATTTCCAAGAACCTGTTTTGTCCAGCAATGAGTTGGATGACGTACAATACAATATATCTACACCAGGGTCATTTGCCTTCGCTGAGAGACCAAACGGCAGTGTTACGTGTCTAATTGGCAGCTTGTTTCAAAATACTGTCAACGTTGTCAATCTGCGAATGCCGACAACTAACAAGGAAGGGGAGAATACATCAGAGGTCCTATCTCAGAGGTTCTCTCGGTCTGTAGGTCTGAGTTCCCATGGTAACCAGGATGAGGAGTTGTCAGCCATAAGAGGCGCAGAGATGGCAACAAACACCATAACTGTTCTCTCTAATTCTCCTCTCTGTAGTAACTCACCTTTAAAGGCAGAGCTTGTACTAAAAACAGCAACCAAACAACAACAGCAGAAAAAGGCATCGCATAAAGGCGTAAAAACAGGCGTTCGTGATCAGCCTCTCACATTCCACTCAAAAGTCAAATCATCAGGCTACTCCGCTGCGGCACCAAGGGCCAAAATGTTTTCACCAAACACGAGCGTTTCAAAGCCGAAAACTTCTACAGTTCCCTTGAAAAAGGCAACGTCCACAGGCTCAAGCTCCGGGGCTTCATTGAAGGAATACCCTATAGACAGTGAAGCACCAACTAACCTGCAGGATAAAATACCGCTCACTGAACAGCCCACCTCTATCAACAGCCTCGTGTTTGCAGTATTTGTGATTGTTTTTCATGGCTTTTTGTTTATCAACAGGGATGGAAAGCACATCGCTTGTGCCTTGGCTAACAAGAGCGCTCACATGCTGAGACCTCCACCTTCAAGCAAAGAGACAGTGTTTACTGGTCATGATGGATCAGTAACCAGCGTTAACTTCAGTCATGACAGCCGCTTGCTGTTGACGTCATCTTGTGACAGGACAGCGAGGCTGTGGAGCCCCGCCCACTCGGACCCTTTGATGACATTCTCATCTGTCAATCATAACTTTGCATCTGAACTTGATAGCTCTGCAAAGGTCAAGGAAAACCCTCCTTTTACCAAAGAAATAATCCAAGCAAGGTTTTATTATGTCGACAAGTTTGTCCTGCTAGCTTGTGGTAACGGTCTTCATATGTACAAGTATCACATTGACGTCGGCCACAAAGATGACGTCAAAAGATACCAGACGAACAACAAATACAAGTTGGTAAAAATATTTCACCAGGAGAGAGCTCAGCAAATCACCTGTTTTTCCGCCATCAACGGATTTCATTCTTACATCGTCCTGTCATGTGGCTCCAATAAATCCATCGAGGTGTTTGATATGAACGCGGCTCGTACAATCCGAGTGGTCCTGGACGCGCATACTCGGCCTGCGCACACGATATGTCAGAACGAGGCTCCATGTTCGTGTGTTCGACGGTATGATGGTCACGTGAACAGATCACAACCAGTTGGTCTCGCTATCAGTCCCTGCGCAAGATTCATTGCTACTGGGTCAGAGGACAGATCGGCGTACTTGTACGACATTCGAGGAAATACATTTTGCCATCGTTTAACTGGTCACACAGACGTCGTGTCGGACGTCGCCTTCCATCCTGCTCAGCCTCAGCTTGTTACTGCATCACTGGACGGCAGGTTACGGTTTTACTCTGATCAAGCCAAACAACTGATGATAACAGAACGCGCACACGGAGTGAAACGAAAGCTAACCGAAGTCGATGGCGATGGAGAAGGCGAAGCAGTTCATGGCCGTTGTCTTCAGCGTGAAACTGTGTTCAATATTTCGATCTGCAAACTGCAGAAAAGCTTTACACGGCCGGAGCCGGTTCTCTTTAGAACCGTGCTCATCTCTAATACGCTTCGTCTCATCGAAGAAGACATTAGAGAAGAGCGAAGGACTTTAGAAACCACTGTTTTGAGTGAACCTAGCGACGAGAAAACATTGGATAGAGTCGTAAACAGGAGCGAGCGAGTCACTCTCTCTGCTCATAATATTGGCACGCGATCACGCGAAGAAACTTCAAAAGTTCTCTAA

Transcript

OS493_024988-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2RRH5	WD repeat-containing protein 27 OS=Homo sapiens OX=9606 GN=WDR27 PE=1 SV=3
Q8C5V5	WD repeat-containing protein 27 OS=Mus musculus OX=10090 GN=Wdr27 PE=2 SV=2
Q2HJH6	U5 small nuclear ribonucleoprotein 40 kDa protein OS=Bos taurus OX=9913 GN=SNRNP40 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002285 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06031 all species →	SERTA	SERTA motif	Motif	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR009263 all species →	Domain	SERTA domain	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR011047 all species →	Homologous_superfamily	Quinoprotein alcohol dehydrogenase-like superfamily	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR042411 all species →	Family	WD repeat-containing protein 27	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44525 all species →	WD REPEAT-CONTAINING PROTEIN 27	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_024988-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_024988-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

50.2Max TPM

11.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.53	5.64
polyp at pH7 6	18	18	4.63	5.73
coral polyp · control treatment	16	16	11.24	19.92
coral polyp · oil and dispersant treatment	16	16	17.60	27.51
coral polyp · oil treatment	16	16	9.11	12.57
coral polyp · dispersant treatment	16	16	29.08	50.18
Polyp	10	10	3.84	6.62

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.64
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.91
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.74
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.60
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.47
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.76
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.39
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.38
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.33
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.02
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.80
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.70
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.01
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.73
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.62
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.56
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.52
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.40
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.35
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.32
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.20
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.92
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.66
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.56
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.56
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.45
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.30
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.80
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.07
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.76
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.50
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.92
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.58
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.53
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.25
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.25
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.18
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.15
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.93
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.70
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.40
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.19
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.81
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.51
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.18
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.62
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.98
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.83
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.46
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.91
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.82
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.39
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.01
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.01
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.66
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.28
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.06
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.90
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.04
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.57
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.21
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.15
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.80
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.72
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.62
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.20
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.19
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.91
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.90
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.80
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.25
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.00
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.18
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.26
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.77
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.96
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.95
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.05
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.55
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.81
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.32
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.45
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.99
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.54
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.80
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.45
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.63
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.62
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.14
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.02
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.99
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.77
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.71
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.53
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.13

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.