Gene detail

Detailed information of OS493_025041-T1 in Lophelia pertusa

Genomic Location: scaffold_120:40333...46972
NR annotation: KAJ7328168.1, hypothetical protein OS493_025041 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025041-T1

ATGGAGATAGACGAGCACGCTATAGAAAGATGTCGTTGGGTTCGAATCAACTGGAAATGGGGGAAAATTGGAGGGCGACAGCTTGGTCTTTTCCTGCGATTCAACCCGGTGGTGACTTTTTTGTCCGCCGCTATCATCTGGTTCTTCGTGATTTGGTGCGCGGTCCAAGCCGATGTCGCTAACAAAGAGATGGCGAAATGGATGGTGTGGATTACCGAAACTTTCACCTGGATGTACATCGGTACCCAAGATGTGTGGGCAATTTTCATTATTGTGCTCTACTTCTCCAAGTATGGAAAAATGAAACTTGGAAAACCCGACGACGAGCCGGAATTCAATGACCTGACGTACTTCACAATGTTATTCGCTGCTGGCATCGGGATTGGTTTGTTCTACTTCGGAGTGGCTGAACCTGTCTGGCATTATGCGCCTGGTGAATATGGAAATCGTTATTGGGACAGGTACAGCGACAATCAGCGAGCCCAGGATGCTATCAATTTGACGTTGTTCCACTGGGGTATCCATGGATGGATCGTGTATGTGGTAGTTGGTCTCCTTCTCGCCTTCGTGGGTTACAGAAAAGGCCTTCCCATGACCATACGCTCATGTTTCTATCCTCTCATTGGGGACAAGATCTACGGCTGGATGGGTGATGCGGTGGACATCTTATCTGTGGTGTGCACCATGTTTGGCGTTTGTACCAGTCTTGGTGTTGGTGTCATGCAGATGAACAATGGCTTCAAACGTCTGAACCCAGCTATCGAGTTCAACGTCACCAACCAAATCATCATCATTTGGTCAGTGACAGCGTGTGCCACGGCTTCTGTAGTGAGCGGCTTAAAGGTTGGAATCCGTCGCCTGAGTGAAATCTGCTTCACACTGGGCATGTTCATTATGCTGATTGGTTTCTTTGCTGATAACACTTGGCATACATTGAATGTGTACGTGCAGAGTATTGGATACTACTTGCAGTGGATTGTACAACTTGGCTTTCACACAGATGCCTTCGCACAACTGGGAAATGCACCCGATGGAAAGCAGGCTCAGCGATGGATGAATGACTGGACCATCTTCTACTGGGGATGGTGGATCGCCTGGTCTCCGTTCGTGGGCATGTTCATTGCGAAGATTTCCAAGGGACGAACCATCCGACAGTTCATCAATGGCACAATGACAGCGCCGATATTGTACGCGTTCTTGTGGTTTTGCATTTTTGGTAGTGCAGGCTTGAAGATGGAGCGTGATGCTGCGCTTGCCAACATAACGTGCGACTCTAGGCTGGGAGGAACTGGATCAACGTCTTCATTTAATGGCCTGTACCGCTTGTCTTGCCGAGGAAAGAACGACATGTGGTTCGATGTGATGGAACAGTACGGTGACCTAGGAACGTTTCTCCAAGTCATTTCACTCATCAGCGTTATTCTCTATTTCGTCACCAGTTCTGATAGTGGTTCTCTTGTGATCGATTGCCTCTCAGCCAATGGCGATCCAGAACCTCCTGTCATACAACGTATCTTCTGGGCCATGACAGAAGGCGCAACAGCTACAGCTCTGCTAAATGCTGGAGGCACAGAGGGGCTTGTGGCTTTGCAGTCCATGTCAATAGCATCCGGTGTCCCTTACACTATATTGCTGTGCTTTATGTGTGTGGCATTATGGCGAGCTGTGAAGATGGAAGGTGGTGATCTTGATCCGCATGGTCCGCAGTTCACCACCAGTCTCTTGGACGTCCTAAGCAGTCCAACCAAATCAAGCGTCGGCAAGGTTCTGCTAGCTGTCATTGCACCGTGGTACTCAATGGGAAATGCTGCCTACAAGATTGGTGGTAAAAAAGAACCTCGGTGGATGTACATGACGCTCCTGGCAGTTCTATTTTACACGTGGCTTATCCTGATGGCTCTGGAACCTGTTGTGAGTGCAATATCCTACGTTGCCTGGTCGATTCTGATCGGGTTTTTTGCCTACGCTACATCCATTCGTTATTCCATTCGCGAGAAGTATAACATATATGGCAACAGCGTAGAAGATTTCTTTGCAGTGATGGTCTTGTACCCTTTCGCAGCCTACCAGATGGATCACCACATGGATCACGCCTATGATTTGGATCGACCAGACTACCACATGGATCATTCGTACGAGGTGGAGAAACCAGCCACTCAGGTGCACAAAGAAGCTCATCCAGCAAACGGTACTTCAACTCCTTCGATGTCTCTACAAGATCTCTCTATGAGTGGGGCTCATTTCAATCCGGCGATTGAAGAAGAGAAAGCGAGGCCTGGAGATACAACCGAAATCATTTAA

Transcript

OS493_025041-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q87NG3	Glycine betaine transporter 1 OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) OX=223926 GN=VP1905 PE=1 SV=1
G3XCN6	Glycine betaine/proline betaine transporter BetS OS=Rhizobium meliloti OX=382 GN=betS PE=1 SV=1
A0A0B5RUB0	Trimethylamine transporter OS=Myroides profundi OX=480520 GN=tmaT PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000591 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04749 all species →	PLAC8	PLAC8 family	Family	Interproscan
PF02028 all species →	BCCT	BCCT, betaine/carnitine/choline family transporter	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006461 all species →	Family	PLAC8 motif-containing protein	Interproscan
IPR000060 all species →	Family	BCCT transporter family	Interproscan
IPR018093 all species →	Conserved_site	BCCT transporter, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30047 all species →	HIGH-AFFINITY CHOLINE TRANSPORT PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0071705 all species →	Biological Process	nitrogen compound transport	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006810 all species →	Biological Process	transport	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02168	betT, betS; choline/glycine/proline betaine transport protein	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025041-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

221.8Max TPM

22.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.03	12.10
polyp at pH7 6	18	18	11.86	44.56
coral polyp · control treatment	16	16	19.96	60.01
coral polyp · oil and dispersant treatment	16	16	42.34	165.27
coral polyp · oil treatment	16	16	12.37	34.22
coral polyp · dispersant treatment	16	16	58.23	221.78
Polyp	10	9	4.26	20.51

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.10
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.86
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.34
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.17
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.08
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.51
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.49
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.45
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.57
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.54
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.81
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.72
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.50
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.37
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.34
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.56
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.27
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.37
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.20
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.28
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.49
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.37
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.05
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.43
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.43
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.37
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.17
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.96
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.74
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.48
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.30
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.43
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.24
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.44
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.92
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.34
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.29
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.94
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.80
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.70
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.92
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.81
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	165.27
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	119.90
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.45
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.81
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.88
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.65
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.09
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.26
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.42
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.70
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.58
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.69
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.23
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.72
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.89
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.22
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.48
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.03
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.25
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.25
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.64
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.05
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.70
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.52
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.17
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.60
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.50
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.93
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.22
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.99
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	221.78
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	214.21
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	135.08
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	129.91
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.64
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.46
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.37
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.07
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.23
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.11
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.27
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.35
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.89
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.60
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.00
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.63
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	20.51
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.67
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.65
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.56
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.57
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.58
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.87
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.58
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.57
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.