Gene detail

Detailed information of OS493_025079-T1 in Lophelia pertusa

Genomic Location: scaffold_120:678621...695073
NR annotation: KAJ7328202.1, Ribonucleoprotein PTB-binding 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025079-T1

ATGAACGGGGCGATTAAGTTAGAGAACAACGCCGAATTAGGGACTGTATTAAACGTCAATCCAAAGGAGGAATTTGGAAAAAGACGATGGGTTTTGATCACCAATATACCCGATGGAGTAAACGTGGAGGATATGAAAGGAAATTTCCTTCATGGCTACGATGTTATAGACATCAGAGTTGAAAAGAATTCAGCTTATGTTCTTCTTGGAAGTCCTGACCAGGCTATAAATGCTATTAACACGCTCAATGGACAGAGTTATCATGGCTATGTTGTCGGCGTATCCCTTGCTCCACCGGAGGGCTTCTTGTTTGTTGGCAATTTGCCGTTTGAATTCACTGAGGAGCAGTTCAGAGACTTAATGAGCCCTTTTGGACCAATCGAGAGAATATTTCTAGTGCGGAGTGTGTTTACTGGAGAGAGTAAAGGATATGGGTTTGTGGACTACATCAACCGCGAGTCTGCTGGTTCAGCCAAACAGCAGTTGATGAGTACAGACTGCCTCGGGATTTCACTGACGGTGAAGTGTTTGAAAGGATTATTCAGTCAGAGTGGGACAGTTACCTTTGCACAGGTTGCCTTGAACTCCCAAACTGGTATATCTCGGGGATTTGCTTTTGTCGATTATGTGACGGCAGAAGAAACAGAAAGAGGACAAAAGGCACACAATGGGGCACTGTTGGACGGCACCAATATCCGCGTGGCTTATGGGACTCCAGGGAGAACAGGGGCGAGCATACTAAGAGGCCAACATAACCCTAGTGTGGGAGTTCAGTCACCATTTGGCCCTCGTCCCAGGGGTCCTTCCCCTCACGTACAGTCTCAAGGTGCAGAGATGATCAGTGCACAAGGGCCACGCCCTCTCATGGCTCCGCGTCCTCTTATGGGATCAGAGCCTTGGCAACAAATGTCACGAGGCTATCCAGGGAGACCGCCAAGACCACTGATGAGGCCTGGTCTACCAGGTGCAAGGTTCATGTCGGTTAGACTCCGAGGGGCCTCTCCAGGTCCAGGGGGTGCAAGAGGTGCTCTTTTTGGCCATGGACCCAGGCCCCTTCTTGGCAGGCCCCCAGGAGCAAGGCCCATGATGAGGTATCCAGCAGGACCCAGGGGCTTTGCTTGTATGGGTGTAGGAGGCCCACCAGGTGTGAGACCCATGCTACCTAGAGGAGGGGCTATGCAACCACGACCTTTAATGGATTTTGGAGAGCAGCTTGATGGGACAGCATTCCCTCCTGAACAGATGCAGGCTGGTCCAGTAGGTATTGACCCCTCCCTGTCCCAGCAGCAACATATGAATGACACCATACCTACTCTTATGGGTGAACCAATGGTAGGAGGTGGATATCCCCCTTCTGCCGACCCAGGAGTGTTTGGTCAAACAACAGTTCAATCCATTGTGCAACAGCAGGAGATGTTAGTCCCTGCTCCAGCTCAGCAACAAGGAATGCTGCCAGGTCCATCTCACCCTCAGGGGCCAAGAGCTGCTGCAGTACCTCAATTGATGCAAGTTCAGACAGCTGGTGCGCCCATTGCCGCATATCCCGGCACCTTGCCTGCTCAGACACAGGTGGCTGTAATACCACAGGTCCCCCAGCCACTCATGGTACCTAACCAGCAAATCCCCAACAGTTCGTTGATGTACGCCACTGCCCCCACCAATGCCATGCCTGCGCAAGCTGTAGTCTCGCAGGTAGTGCAACCTGAACCAGCTCCACTCATGTCAGCACCAGCTACTCACAGTGTTGCTCCTGGAGCTGCTGTAGCCGGCCAAACTGATCTTAATACAGGGCACTATGGCATGCATGGAATGCAACAGATGGTACATGCTCAAGGTGACCCAGTTGGTAATACAGCAGTGAGTTCTGGGTATGTTGTACTCCAAGCAGACTCAACGCAACAAACTGCATTTTATGCACCACATGACTCGCAGTCTTACTCGCTGTCTCAATATACCACAGCAGGTCAGACACCTGGACATCAGCAGCAGCCTATGGTTCAGTTACCGGTGGGTGCAGTGCAGCCAGGCGGTGCTGTCATTCAGACCCAGGTGCCGTCATCTCAACCCACCCCTGTACCCCTGATGGCCCCTCAGATGCCGCAGTACCAGTGGTATCAGCAGGCCCCATCTGCTGTTAGTGGTGTAGCAGGGTCCACTTCACTCGCTCAAAACACACCTTTGCAAGTGACATCTTTAGGAGGAACCCAGTGGCCTCAGACTGAACAACTGTCCACTCAACCTTTGATGACTGTCCCGACCAGTGCGATGTATGGACACTACCAACAACAAACTCAACAGTACCAGCCACCACAAGCTGTGGCACCCAGCACCGCCGCAGAAAATGTAGTCTACTACCAACAAGCTCAGGTTCAAGTACCAGGTGCTCACCCACAACTCAGTCAAAAGAGACCCGCAGAAGGAGACACTGGACTGTACAGTCTGCAGGGACCTCCCAGTTACTATGACAACAGCAAACGACTGAGATATTGA

Transcript

OS493_025079-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5XI28	Ribonucleoprotein PTB-binding 1 OS=Rattus norvegicus OX=10116 GN=Raver1 PE=1 SV=1
Q8IY67	Ribonucleoprotein PTB-binding 1 OS=Homo sapiens OX=9606 GN=RAVER1 PE=1 SV=1
Q9CW46	Ribonucleoprotein PTB-binding 1 OS=Mus musculus OX=10090 GN=Raver1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005607 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00076 all species →	RRM_1	RNA recognition motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR050502 all species →	Family	Eukaryotic RNA-binding	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48025 all species →	OS02G0815200 PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14411	MSI; RNA-binding protein Musashi	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025079-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

29.7Max TPM

8.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.69	29.68
polyp at pH7 6	18	18	10.02	22.27
coral polyp · control treatment	16	16	9.77	23.83
coral polyp · oil and dispersant treatment	16	16	8.88	19.20
coral polyp · oil treatment	16	16	8.09	23.29
coral polyp · dispersant treatment	16	16	6.01	17.23
Polyp	10	9	3.87	8.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.68
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.05
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.86
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.65
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.01
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.93
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.34
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.76
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.96
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.40
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.39
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.28
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.01
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.78
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.98
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.25
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.27
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.13
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.27
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.05
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.56
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.87
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.80
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.66
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.06
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.99
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.62
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.83
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.45
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.24
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.16
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.83
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.54
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.20
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.61
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.83
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.56
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.27
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.18
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.71
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.76
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.46
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.82
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.62
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.20
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.56
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.83
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.45
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.90
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.47
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.34
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.10
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.94
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.69
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.45
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.13
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.65
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.59
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.38
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.29
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.04
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.72
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.46
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.82
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.44
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.27
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.03
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.88
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.03
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.23
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.90
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.70
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.44
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.84
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.23
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.05
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.63
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.01
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.74
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.25
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.85
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.85
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.15
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.74
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.93
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.17
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.04
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.34
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.48
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.26
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.45
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.71
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.34
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.41
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.16
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.74
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.