Gene detail

Detailed information of OS493_025182-T1 in Lophelia pertusa

Genomic Location: scaffold_121:1044678...1065308
NR annotation: KAJ7390479.1, regulation of synaptic plasticity by receptor localization to synapse [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025182-T1

ATGGAAACTGTCAAACAGCTGTTAAACTACCATCCTAATCTCCTTGAAGATGTAAATATTGTCAGAACCCACACTCCCCTCCATCTTGCCGCCAGAAACGGTCACATGAATGTGGTGTCATACTTCCTCAGTTGTGGAATGGATGTTAATATAACGGGTACTTCTGGGACAGCTCTACACGAAGCTGCCTTGTTTGGTAAAGTGGATGTTGTCAATCTTCTCTTACAGTGCGGAATTGATGTCCAGGTGGCAGATAGCAACAACAAAACAGTGTTGGACCTGTTGGCCTCTCACCCCTCAGCAAGGACAAGAGAGATCAAAGATCTTATTTATGCATACAGCCTCAAAGAACCTGTGTCTAGCATAAAACGGAAACTAACTGACGTCCAACGTGGTATGAAGTATTCATCTGGGATATCAAACACGTTCTCTGGATTTTCTGCAGGACGTCCCAAGTCAGCAGTCCTCCAAAGGAATCTGAGTTATGATAGTGTGCCAAGTCGTCAAGCCATGGATCCTGACTTTCTCCGGAGATCTGGCACATATGATGCAGTCCCAGCACCAAGAACAAGGCAAGAATTGATGAAGCAATCCAGTTATGATACTGTTCCACCACCTAAAGAAAGACACTCTAGATCTCTTGATTGGACGAAATATGATGATGTTACGTCCAGATCTCCTGACACCGTCCATCTGTTACATACTGGTAAAGGATACGCCCTGCTGGGGCCTGCTGAGCAGCCTTCCACAGGCTCACCCCCTTTGCTCAGTGCAAACGAGATCACAGATGGATACACCCTGCTTGGCTCCCCAGCACAGCCTGGGGCAGCTGCTAATGCACTGTGCCCACTGCGCCCGGACAGCACCTACTCTGAAGTCAGAAATGAAGGGGAGAACTTTGTGCCAGCGAGGATGAGCCCGCCTTCTCAAATAGCATTTGATGATTACTCTCGCCTTGGTTTTCCATCAGCTGCTGGAGGGGAAAGTGAACCTATGGCCATACCAGGAACGGTTGGCGAAGATACACCCAGCTACTTCTTGGTTGGTGAGACAAGTCACCAGCTCTCACAGTCTCAGAGAGAGAACAACGACAGGTATGACTTTGTTGTACCGAGAACTGGTGCGAATCAACAGCAGAGTATCTATGAAGTCCCCCCCATGTCATTAAGAGGCAAAGGGAACGGTCAGGAGGGGGATGACACACCCAGTCACGCCCCTTCTAGAACATCTAGGGGCCAGTCGCTGGACATGTATGAAAATACCAGCATCGGAACTCAACAGCAAGTTAATCAGCCACAGCAGCAAGCTACTAGTTATGACTTTGTTACTCTACCGCCTCGGAAAGCCACTCTGGAACAATCTTCGTATGATGTGGTCCCTCCACCAAGTCGAATACTCCAGGATCAGCGAAGCAGCCCAGAGCTTCACACTTCACTGACAGGTGCCAGGGTTCAAGCAGACCAACCTTGCCCTCTGGACACACAAGGATACGAATTTGTACAGCTACGAAAGCCAGGTACTTTAACAGATGACTTAGCACCTGAAATGCAGCCCCTTGCCCCTTTGCCAGGGTATGAGCCCATGGGCCCTCCATCGGATGAGGGGTATGAAATACTCTCCCCGCCCGCGGAGATCCAGCAGCAATTACATGCAAGCAACCGTGGAGATTACGAGACTCTTGCTATGGTTGGTCCTCAATGGACCGGGTCCCAGACAGGATCAGCACGGATGACCCAGCAACCGTCTAGCTCGATGAACATTCCCGTGTCAGCACCTTTGTATGAAGTGCCACCAACTTTGTCACCGCCTGTGTATGAGATCGCCCCGCCTCCGAGGAACCTACATGTACCACCGCTTCCTCCTCGGCCAGCTCCGGCTGCTCCGCCCCAGTCCCCTACAAGCGATGACGAGGTGCACGAGGTGCACGAGGTGCAGTGGATTGAAAAAGAACAAGTTCAACCAAAGGTCCCCCCACGGAGACAAAACGAATATTCCGATTGGCAGCCTGTCATGAGACAACAAGAACCACCCCTGTCACCTGGGAGGCCCCCTAAAACAGGGGCCTACGAACAAGTGCGCCTTGAGGGCCCTGAAAAGGCGGGAACGATAGACTGGGAGAGAGTCCGGCGGATGAATTCTCGAGGTTCCGGGGGGGATTATTGCACACTGTCGGCTACAGCAGTAGGACCCAGTGAAGCAGCAATGAATAGAGTGAGCACCGCGTCGAGCGAGATGTCTTTCATGTCAGAACCCACGTTAACCCCGCCATTCTCCCCTCCCTCGCCTAATACTGCAAAAGCAATGCTTTTTGAAGCGTTCGGGACTCTTCAGCCTTCAGTAGACATGTCAACGATTCCAGAGGTACCCGAAGATGTCAAAGATCAACCCGAACCTGAACCCGATCCCGAACCCCCCCGTCCCATGCCACGTAAAAGGAATCAAGATCCTTTCAGTTTTCCGCCTGTTGCGGCCACGGCCTCGCCGAAGATTGAAAGCCCGAAGAAGAGCGATTTTGCCGAGTTGCACAAGCGCTTTTCACCGTATTCTTCTCGAGAAGACATCTTCACTGAGTTCAGCGCTGGGTCAGAGAAGGAACGCCAGGAGCCAGATGGAGCCGAGGCTGGGGATGATGTCAAGCCATCGGCATTGATCTACGAGAACGTGTTGTTCAAGCGAAGTGACGACGCAAAAAACGTTGAGACAAGCTCGAGTCAAACGCGCGAGAACGGGAGCGTCGCGAAGCGAGGAGAATCAATTGACAGGCCTGGATCCTACAGGTTAAGCTCACTGGCAGCGGATAGTCCCATGGACGAGAGAGACGAATGGGAGAAGATCGAAGCTTTCCTGTCATCTATTGGACAGATTGAAGTACCTCAGACTTTGGAGCAGCAGATTGCTGATGCAGGCAAGGCAGACACTGTGCCAGGCTGGCTCAAGGCGCTGGATCTTGGTCAGTACGAGTCGTACATGCTGGCTAATGGATTTGACGACATCAGCTTCTTGAATGGAGTTCTCGAAGATGACGATCTTTTGGACATAGGAATTGTAGACTTTTCTCATAGAAAGACAATTATGGAAGCGATGAAGTCCTTACCAGCCTGTCCCCGGCTTTGCGACCCGGCCTTAACCAAGCCCGAGAGTTTGGAGGACTGGTTAGAGCTGCTCTGTCTTCCCGAGTATTTTGACGTGTTTGAACACAACGGCTTCACTTCCATGGAGAGAATACACATGCTTTGGGAGGTGGAGCTAACGTCGGTTTTGGAAGTAAATTCTCTCGGTCATAGAAAACGAATTCTTGCTTCATTGAAAGAAGATGTAAAAGAACTGGAGAGGAAGGAACAAGCACAAGCCGTAAACCTGGATGATAGCAGTGCTGAACTCGAAGTACAATTGGCTGAACTCAAGATGTACTGCCCAGATGAGAAACCGCCGACCATACCGACCGCGACAACCAGCGCGGATGACCTGATGGCGGCTGCTGAAGAGATGATGAGGGGCAATAAAGAGGTGGTTCAAAAGAAATCCAAAGTAAAAAGATCGAAAAAGTGGAAACATGACTCGGCGGTGTTGATTAATGGAAGCGTTAATTATACCACTTTGTATCTCGGGTCACATGCGGTCAAGACAATCACAGGGCTGGACTCTACCATTGAAGCCTGCCGTAAAATGAGGCTTTCCACAGCCAAGCTGCAGAAGATTCCTTCAGTCACGTTGTCTGTGTCCGTAAAAGGAATCAAGTTCATTGATGCCCGGTCGAAGATTATGGTGAGTTATCACGACATGAAGAACATATCGTACATCACTCAGGATCCAGAGGACAGAAAAGTGTTCGCTTACATCGCCAAGGACGCCAAAACCGAAAAGCATTACTGTCACGTGTTCAGGGTGGATTCCACTGCGTTGTCTATTGAAGTTACTATGACCATAGGACAAGCTTTTGAGCTGGCCTTCAGCCAGTTCGTGCAGGCTCAGAATCAACATCCTGAACAATGA

Transcript

OS493_025182-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P59672	Ankyrin repeat and SAM domain-containing protein 1A OS=Mus musculus OX=10090 GN=Anks1a PE=1 SV=3
A5PMU4	Ankyrin repeat and sterile alpha motif domain-containing protein 1B OS=Danio rerio OX=7955 GN=anks1b PE=3 SV=1
Q7Z6G8	Ankyrin repeat and sterile alpha motif domain-containing protein 1B OS=Homo sapiens OX=9606 GN=ANKS1B PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003331 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF00640 all species →	PID	Phosphotyrosine interaction domain (PTB/PID)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR006020 all species →	Domain	PTB/PI domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR033635 all species →	Family	Ankyrin repeat and SAM domain-containing protein 1/Caskin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24174 all species →	ANKYRIN REPEAT AND STERILE ALPHA MOTIF DOMAIN-CONTAINING PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K21413	ANKS1; ankyrin repeat and SAM domain-containing protein 1	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025182-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

34.7Max TPM

15.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.98	24.60
polyp at pH7 6	18	18	14.23	22.43
coral polyp · control treatment	16	16	20.39	34.10
coral polyp · oil and dispersant treatment	16	16	13.72	19.85
coral polyp · oil treatment	16	16	18.32	34.73
coral polyp · dispersant treatment	16	16	12.36	20.19
Polyp	10	10	9.56	18.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.60
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.78
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.46
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.26
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.31
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.23
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.33
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.96
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.26
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.56
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.15
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.38
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.35
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.13
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.93
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.57
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.43
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.53
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.24
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.16
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.87
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.83
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.25
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.23
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.40
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.17
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.17
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.41
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.10
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.86
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.79
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.65
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.29
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.22
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.52
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.41
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.57
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.42
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.01
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.46
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.41
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.51
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.17
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.97
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.56
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.42
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.19
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.66
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.03
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.10
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.03
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.73
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.88
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.89
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.26
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.99
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.73
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.36
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.74
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.30
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.65
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.90
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.50
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.79
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.69
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.43
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.26
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.63
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.85
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.68
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.45
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.55
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.22
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.97
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.26
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.53
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.31
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.18
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.77
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.71
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.01
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.13
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	18.18
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	15.60
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.28
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.25
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.23
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.39
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.65
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.02
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.72

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.