Gene detail

Detailed information of OS493_025505-T1 in Lophelia pertusa

Genomic Location: scaffold_126:13528...63750
NR annotation: KAJ7328106.1, UDP-glucose:glycoprotein glucosyltransferase 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025505-T1

ATGGCGGCCGAGAAGTGTCTGAACAGCAAGGTTCTCTATTTGATGTTGGCCACGTTACTGACTCTACTGTCATTAGTCCATCATAGTTCATGTAAATCTAGCAGTTCTAAATCAATAATTGCTACACTAGATGCAAGATGGGGGTCAACACCACTCCTTCTTGAAGCAAGTGAATATTTAGCTGCAGATAGCAATGAGAACTTTTGGAAGTTTGTAGATTCATCTCAACATATATCATTCAGTCATGATTCAGATGAATATAAACATATTTTAGAAGCTGCTGGACAAGTGGAATTATTCAATAAGGTAGCCCATGATATTCCAGCACCAGATTGTGAAGCATTTGCTCAAATTGGCAGTAAGACAATATGTGATGCTGTAGAAGCAGTTTCTTTTATCAAACAATCTAAAAACATAGCCTTATCACAAAGTTTTGAATTTGATCACCACTATCCTAACTCGGAAAACAACTCAGTAGCAGTGGTCTTGTATGGGAGGATAGGATCCGATTCTTTCTGGAGATTTCATCAAGAGCTTGAATATTTGGCAAATGATGGACAGGTGCACTACATTCTCAGGCATTATTTACAGTCACCATCGGAGAGAAAAATCAGGCTGTCTGGGTATGGTGTGGAACTCGCTGTAAAGAAAACAGAGTATAAAGCTGTGGATGATAGTAAAGTACAGGATGACACAGAAGGAAAGGTGCAGAAAACAGAGGAAGTGGATGATGACGAAGTTGAAGGTTTCCTTTTTGGAAAGCTTAGGAAACTTTATCCAGAGCTTAATGAAAACCTTGATCAGTTTAGGACACACTTAAAAGAAAGTGCTCATGAAATGGCCCCTTTGAAAGTTTGGCAGTTACAAGATTTGAGTTTCCAGGCAGCCCAGCGGGTCATGTCCTCTGATCCACAAAGAGCATTAAAATTGTTGAGAGATATCAGTCAGAATTTTCCAATGCAGACCAGATCGCTAGTTAAGACAAAGGTCAAAGAAGAAATGAGAAAAGAGATTCAATTGAACCAAAAGCATTTTGCACAATTTGGTCTTGATGCAGGAGACAGTGCCTTGATGATAAATGGACTTTTGCTCCAAGTGGAGGATTTAAATCCTTTTCAACTATTAGACTTGTTGCGTGGTGAAGCACTCGCAATTGACAGACTTGCCTCTCTTGGAATCAAGGGTGAAGCTCTCGGCAAACTTGTGTCTCTTTCTACTCAACCAGAACACGAGTCATTTGTGTTGGATGCCAGACATGACTCTATTGTATTTATCAATGACCTCGAAAAGGATCGACAATATTGGGGATGGCCTTCTGATCTACAAGATATATTACGTCCAACATTTCCAGGAATGATGCGCTACATCGCCAAGAACATTTTTAATCTGGTTTTCTTTGTCGACCCATTGGATATCAAAGGCATTGAACTACTTAAGGTTGCTAACGAATTACTTCAGAATTCATTTCCTGTTAGGATTGGTCTGTCATTGGTTGCCAATGCCCCTCTGAATGTTGAAGTCGATGCCCACACTGATGCTGGTGTTGGAATAGCACGAGCATTCAGCTTCATTACATCTGACAAAGACACTCGCCAGGCATTTGATTGGCTCATACAGCTTTATAACAGGTTGCCCGAAGGTGAAGTACCATCTGCAAAGAAGGTGGTGGACTCATTTACAGCTTCATTTGGCAAGGATGATGCAGAAGAAGCTTTTGGTGAAGACTCTGAGTATGATGAAGATAGAAAGTCCGCGCAACGTTTCTTTGACAAAACAGGATTTCATGAATTACCACAAGTTATACTTAATGGAGTGCCAATTGACAGTGACGAGTTTGACAACTTAGATGAAGCTCTTATACGAGAGGTTATGATACAAACAAGCCCCATACAACATGCAGTGTTTTCGGGCTCAGTTTATCGTCACTCCAGTGTGTACGAGTACATCATGAGTCAACCAAACGTAGTAGCAAGGGTGAACAGCATGGTTCAATCCATGGAAAGACCTTTTATGGACCTAACTGGCACTCATGATATGCCAGGTGCAGATGTAGCGATGAATGATCCTGAAACATTCGCTATGCTTGATAGTTCTCAGATGGCGTCCGTAATTGCGAAAGACTTGAAATACTTCACCAAACAAGGAGAGGAGCTTAGTTTAAAGCCTGTAACTAACTGGGTGATTGCTGATCTCGCCAACAAGGAAGGGAGATTTCTTGTTAAGGCAGCTCTCCAACAAATGAAATCATCGTCAAGTACAAGAGTAGGACTTATCCACAATCCAACAATAAAACAGACAGATGATCAGCCAGAGCTGCTTCAGATTGCCAGGACTGTCGAGGCAGTGTTGTCGTCAAAAAGTCACGTGACACCGGCAATGCTAACATTCATAGAGAAATTGCTAGACGAGAGCAACGACTTTGATAAACTGTCCTCAGATTCCAAGGCAATGGCGGACCTCTTAGCAGAGACTTCGGGTCTGAAAGCAGAAGCCATTAAAGCCAAGCTGACTGATCAGAAAGCCTTCAAAGGCAAGCTGTTCTCTCACCAAGCTTTCTGCACACAAGTTGTTAATCTTCGTCCAGGACAACCTGTTGTCGTAACTAATGGAAGGGTTCTTGGCCCACTTCTTGGAAACACTTTGTTCACTGAAGAAGATTTTAAACTCCTTGAGAACTTTGACATGGATTTATATGCTCGCAAAGTCAGAGATCAGATTGATGAAATGACATTTGAAGGCTTATCAGCTGATGATGATACAAGTGAATTTAGAAGTGATATCATCATGAAAGCATCCTCTGCACTGATCAGTCGAGACAAGAGGTCTCGCCAGGAAATTACTTTTAAAGATAGTGAACACAGTGTTATGAACATCAAGCCGAACCTAGAAGGTGCTAGTTTTGATGTAGTGGCTGTTCTGGATCCTCTCTCATTAGCTGCTCAGAAAATTGCCCCAATACTCATGGTTTTCCAAAATGTTACAAACGTGAACATCAAGCTTGCCATGAACTCCCGTGAAAAGCTCTCCGAGTTGCCTTTGAATCGCTTCTACCGATATGTCCTGGAACCTGAAGTGGCATTTGATGAGGATGGAGCCATGACAGAGGGTCCATTAGCCTTGTTTTCTGATATGCCGCAGTCGGTACTCCTTACAATGAACATGGACACACCTCTCGGGTGGATGGTAGAGGCTGTCTACGCACCGTATGACCTGGACAACATCAAGTTACAGGAGGTGGATAATCAAGTGATTGGAACATATGAGTTGGAATATATTTTTATCGAAGGCCATTGTTCGGACTTTCACACCAGACAACCACCAAGAGGATTGCAGTTCACTCTTGGAACTCCGAGGAACCCTGCTATGTTTGACACAATTGTTATGGCGAATTTGGGTTACTTCCAGCTCAAAGCTTACCCAGGATCTTGGTCGCTTAGAGTACGAGAGGGCAGATCGTCTGAAATTTACGAGATTGAAAGTGTTTCTGGAAGCATTAAGGAAGACGACAGTCATTTTACAGTCATTGTTGATAGCTTTGTCGGAAAGCTTATGAAAGTAAAGGTTAAGAGAAAGCCAGGCATGGAAGGAAAAGATCTCCTCAGTGAATCGGACAGCAAGTCTTCAGGAGGTATATGGGATTCACTCTCAAGCATGGTTGGAAGTGAAACAAAAGAAGAGCTCCCTAAAGATGAAACCATCAATGTTTTCTCTGTGGCTTCAGGTCATCTCTATGAACGTTTCTTGAGGATAATGATGTTAACTGTTATGAAGAATACCAAAAACCCTGTCAAGTTTTGGTTCCTGAAGAACTTCCTGTCACCCACGATAACGGCCTTCCTTCCTCACATGGCCAAAGAGTACGGTTTTGAGTACGAACTTGTGCAGTACCACTGGCCTCACTGGTTACACGCCCAAACAGAGAAGCAGAGGGTTATTTGGGGGTACAAGATTTTATTTTTGGATGTTCTGTTCCCTCTCCATGTGAAGAAATTCATCTTCGTTGATGCAGATTTAATTGTAAGAGCGGACTTAAAGGAGCTCAATGAGATGAACTTGTATGGAGCTCCTTACGCGTACACGCCATTCTGTAGCAGTCGTACAGAGATGGATGGTTTCAGGTTTTGGAATAGTGGTTACTGGAGAAGTCATTTAGGTAGAAGGCCTTATCACATCAGTGCGCTTTACGTTGTGGATTTGGATCGGTTCAGGCGACTTGCTGCTGGTGACAGGCTGAGAGGACAATATCAGGGCTTGAGTCAGGATCCAAATAGTCTGTCTAATCTTGATCAGGACTTGCCCAACAACATGATCCACCAAGTTCCCATCCGGTCCCTCCCTCAGGAGTGGTTTGTGGTGTGA

Transcript

OS493_025505-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P5E4	UDP-glucose:glycoprotein glucosyltransferase 1 OS=Mus musculus OX=10090 GN=Uggt1 PE=1 SV=4
Q9NYU2	UDP-glucose:glycoprotein glucosyltransferase 1 OS=Homo sapiens OX=9606 GN=UGGT1 PE=1 SV=3
Q9JLA3	UDP-glucose:glycoprotein glucosyltransferase 1 OS=Rattus norvegicus OX=10116 GN=Uggt1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003077 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06427 all species →	UDP-g_GGTase	UDP-glucose:Glycoprotein Glucosyltransferase	Domain	Interproscan
PF18404 all species →	Glyco_transf_24	Glucosyltransferase 24	Domain	Interproscan
PF18402 all species →	Thioredoxin_14	Thioredoxin-like domain	Domain	Interproscan
PF18401 all species →	Thioredoxin_13	Thioredoxin-like domain	Domain	Interproscan
PF18400 all species →	Thioredoxin_12	Thioredoxin-like domain	Domain	Interproscan
PF18403 all species →	Thioredoxin_15	Thioredoxin-like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029044 all species →	Homologous_superfamily	Nucleotide-diphospho-sugar transferases	Interproscan
IPR009448 all species →	Family	UDP-glucose:Glycoprotein Glucosyltransferase	Interproscan
IPR040497 all species →	Domain	Glucosyltransferase 24, catalytic domain	Interproscan
IPR040692 all species →	Domain	UGGT, thioredoxin-like domain 3	Interproscan
IPR040694 all species →	Domain	UGGT, thioredoxin-like domain 2	Interproscan
IPR040693 all species →	Domain	UGGT, thioredoxin-like domain 1	Interproscan
IPR040525 all species →	Domain	UDP-glucose:glycoprotein glucosyltransferase, thioredoxin-like domain 4	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11226 all species →	UDP-GLUCOSE GLYCOPROTEIN:GLUCOSYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003980 all species →	Molecular Function	UDP-glucose:glycoprotein glucosyltransferase activity	Interproscan
GO:0006486 all species →	Biological Process	protein glycosylation	Interproscan
GO:0005783 all species →	Cellular Component	endoplasmic reticulum	Interproscan
GO:0018279 all species →	Biological Process	protein N-linked glycosylation via asparagine	Interproscan
GO:0051082 all species →	Molecular Function	unfolded protein binding	Interproscan
GO:0071712 all species →	Biological Process	obsolete ER-associated misfolded protein catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11718	HUGT; UDP-glucose:glycoprotein glucosyltransferase	EC:2.4.1.-	Glycosyltransferases	ko01003	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025505-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

17.4Max TPM

7.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.57	9.56
polyp at pH7 6	18	18	6.20	10.55
coral polyp · control treatment	16	16	9.49	13.56
coral polyp · oil and dispersant treatment	16	16	8.45	15.64
coral polyp · oil treatment	16	16	8.70	15.73
coral polyp · dispersant treatment	16	16	8.10	17.44
Polyp	10	10	3.88	6.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.56
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.47
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.23
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.14
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.30
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.22
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.96
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.33
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.24
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.10
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.07
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.42
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.14
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.09
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.55
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.19
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.30
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.80
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.61
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.44
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.27
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.11
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.89
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.73
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.68
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.79
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.73
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.33
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.17
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.56
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.16
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.16
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.92
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.68
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.70
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.06
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.42
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.75
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.27
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.02
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.81
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.01
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.64
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.71
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.50
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.62
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.18
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.09
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.05
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.35
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.62
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.48
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.38
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.61
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.37
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.91
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.81
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.79
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.73
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.48
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.75
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.55
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.56
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.27
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.54
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.52
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.12
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.90
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.45
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.51
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.41
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.44
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.17
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.29
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.02
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.41
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.26
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.21
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.54
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.20
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.38
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.60
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.47
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.10
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.30
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.80
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.81
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.59
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.17
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.03
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.96
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.88
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.80
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.51
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.41
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.63

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.