Gene detail

Detailed information of OS493_025554-T1 in Lophelia pertusa

Genomic Location: scaffold_126:786261...815691
NR annotation: KAJ7328149.1, metalloendopeptidase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025554-T1

ATGATTTCTTTAAATGCAATACCAGTGCTGTTGGGTCTTGTTCTCGGCATCGTAACCACAGAGTCGCTTGCGTCTCCCAGCAATCAAAAGGCTCCAGCTCTTCACCAACGAATGACGAAGAGGGAGATAGCGAAATATTTTGGAGCAAGCTCTCATGATGAAGTACCAGAGTATGAAGTTGTCTCGCCATTCCAAGCAGACGAAGCCGGGAAATTCATTGCACATGAACTTTACAAACCCAGTCGCAGAAAACGAAGCACAGCTCAACCAAACTCCTGGTTTTACAACATGGATGCGTTTGGTTTCTCGCTTCATTTAAACGTCACCAAGGCCAAACCTATTCTAGCCCCTGGATCCATTGTAGAGACCACAGATGAAAATGGCAGTAAATCGTACACCACGCCACCCAAGAATACGTTTTATACTGGTCACGTGGTGTCGCATCCGGGTTCTGTAGTTGCTATTAGCAACCAAGGTGGTTTGACTGGTATGATCAACCTTATGAAGCAGGCACTTTTTATTCATCCTCTACCGAATCATCTTGCGCAGGATTATGGGTCCACTAGTGGTGGCCAGCCTCATTTGATATATAGACGATCATTGGATGATGTCATTGGAAAGGGATGTGACGTCCCAGACTTTCAAGAGCGCAACAAAAGGAGCTTGGAAACTAACCGAATCAAGCGATCTCGCGACGAACGTTCAACGTCTCATAAACACTTGGAGGTTGCCATGGTAGCGGATGACTTGGTAGTGAAGAGGCACGGCGAAGTAAACCTGACTGAGTACTTACTCATGCTAGCACACGTGGTTGACATGATGTTTCACGAGGACAGTGTCGGAGAAAAGAAATTGACTTTGGTCGTGGTAAAAATAGTTATCAAAAAAGATGGGCTGGGTTACGACTCGTCAGCAAACAATCGAGAGAGAATAAGTAAACTAACAGACTGGGGAGAAAAGAACATGCCAACCTCAGACAAAGATCCTGCTCATGCGGACATGCTTATCCTACTGACAGGGTTTGGCCCAGATGGGTTCTACATGCGCCACGAAGTTCGGCAGAACTGTAACAACGACATTGGCCTGGCGTCCGCCATTATCATTGCTCATGAAGCAGCTCACACATTTGGACTTGGACATGACGGAAAAGGTGCAAGGTGTAACAACGGAGAATACATCATGTCCAGTGCTGTGAGTGATGGTCAAAATGCATTCAAGTGGTCACCGTGCAGTAGTAAACTCATCCAAGATTTTCTCACTGGTTCTGGCTCGTCCTTGCAGGCTGCAGTATGGCTCACAATACTACCAATGTCCCAAGAGAATAGCCAGCTGCGGCTCCTTGTTCTGCACCAAGATAGTTATGAATGTGTGAGCCTTTCTGCCCCGCCTATCGATGGCACGCGTTGCGGAGATCGTCACTGGTGCATAAAGGGTGAATGTGTAGACGATGGCTCTCCAATGATTGACGGAGGATGGAGTGATTGGCAGGACACACAGTCGTGCACTCGAACGTGCGGTGGAGGTGTGCACTGGAAAACCAGAACATGTACCAGCCCCACGCCAAAAAATGGTGGACAGAAATGCGAGGGATCAGAAAAAGGATTGTGGAAAATGTGCAACACACAGCCTTGCCCTAAAGGTTCCACAGATTATCGCCTTCTTCAGTGCAAAGCACTTGACCAGGACTATACGGACACCTATTGGGGATCAGATCCCTGCACCCTGATATGCCGTGAAGGAAGCAAGGCAGAACCTCGAGGCCGAGTTAAGGACGGGACTCGATGCAACGGCAACCCCAGGATAAAAGATGTCTGCATTGAGGGACTCTGCAAGCCCGTTGGTTGTGATAACAAATTGGACTCAGGAGTCATGCATGATCGCTGTGCAGTATGTGGAGGCGACAGTTCCGCATGTAGCTACGTCAGTGGGAATTATACAAAGAACTGGCGTAAATGGGGCACAGGGAGACCAGATGAAATCATTAGTATTCCAACTGGTTCCACTAACATTTTTGCAAAGATGAAAAACAAAAATAACAATTTTTTGGGAGTTAAAAATACGGAGGATGAATGGGTGTACAGTGTTGGATACACGTGGAGTACTGTAGTGAAAGCTGCTGGAACAAAAGTGGCTTACGATCACGAGCGTAATTACTGGAACGACAAAGTTGATATTGCAGGACCAACTAAGGAAATTCTTAAACTCATGTACGTGTATAATTCAGGTGACAACCCCGGAGTGGAATACCACTTCCAATCGCCCCAAAAAAGTGAAATATCTCCTGATCAGGTCGAATGGAAGATCGGGGACTGGGACGTGTGCTCTGAAGACTGTGCTGGAGGTTACCGGAAGAGACTTGTGGAGTGTGTACGTATAGATGACAAAAGTTACGTTAATGATGAAATATGTCTCAAGACCGAAGCCAAACCACCGAAGGAACAGGCTTGCAACACGCAGCCATGTCCAGCCGAGTGGTACACGTCAGGTTGGCGTCCATGTTCAAGGACGTGTGGTAAAGGTATTCAGTTGAGAGTGATCGTGTGCAGGCAAAAGATAAGCCAGGATGATCATGAGACGCTCGAGGATTCCTCCTGTCCAAACCCGAAACCGATCGGTATTCTACAACAAGAATGCAACAAGGTCGCCTGTCCAGCTGCTGAATGGAGGCATTTAGCGTGGAGTGCGTGCTCCCGTTCGTGCGCAGTTGATGGAGTTGGTGGTAAGATGACTCGCACTTTAAAGTGCATGAAACTGAACTCGCAGGGAATGCTGGTATCTGTCTCAGACCTCCAATGCGTTCACGCGGTCAAACCTCCAACAGAGGAAGAATGCAACGCCGACATTACCTGTCCACATGCTATACAAACCCCAGATGGAAAACGATTAATACCCTTGGGATGCTTCAAGGACAAGAAAACTGACCGTGCTTTGCCGGAGTTAGTGAAAAATATGCGCGGAAAGATCAACTGGCAGGACATGGAGAAAACTGTTAAGCAGTGCGCCGATAGTGTGACGGAGAAGGACTCCCATCTCAAGGTATTTTCGGTCCAATATTACGGGGAATGTTGGACAGGAGGTGATGGAGACAAGACTTACAGTGAGTATGGATCGTCCAGTAACTGTTGGAAAGGAGTAGGAGGAAGCCGGACCAATTTCGTGTACGAGTTTATTGATGATGATAAGAACCCTTAG

Transcript

OS493_025554-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q1EHB3	A disintegrin and metalloproteinase with thrombospondin motifs 7 OS=Rattus norvegicus OX=10116 GN=Adamts7 PE=1 SV=1
Q811B3	A disintegrin and metalloproteinase with thrombospondin motifs 12 OS=Mus musculus OX=10090 GN=Adamts12 PE=2 SV=2
Q9UKP5	A disintegrin and metalloproteinase with thrombospondin motifs 6 OS=Homo sapiens OX=9606 GN=ADAMTS6 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000160 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13688 all species →	Reprolysin_5	Metallo-peptidase family M12	Family	Interproscan
PF01562 all species →	Pep_M12B_propep	Reprolysin family propeptide	Family	Interproscan
PF19236 all species →	ADAMTS_CR_3	ADAMTS cysteine-rich domain	Domain	Interproscan
PF05986 all species →	ADAMTS_spacer1	ADAM-TS Spacer 1	Domain	Interproscan
PF17771 all species →	ADAMTS_CR_2	ADAMTS cysteine-rich domain 2	Domain	Interproscan
PF19030 all species →	TSP1_ADAMTS	Thrombospondin type 1 domain	Domain	Interproscan
PF00090 all species →	TSP_1	Thrombospondin type 1 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000884 all species →	Repeat	Thrombospondin type-1 (TSP1) repeat	Interproscan
IPR002870 all species →	Domain	Peptidase M12B, propeptide	Interproscan
IPR024079 all species →	Homologous_superfamily	Metallopeptidase, catalytic domain superfamily	Interproscan
IPR036383 all species →	Homologous_superfamily	Thrombospondin type-1 (TSP1) repeat superfamily	Interproscan
IPR045371 all species →	Domain	ADAMTS/ADAMTS-like, cysteine-rich domain 3	Interproscan
IPR010294 all species →	Domain	ADAMTS/ADAMTS-like, Spacer 1	Interproscan
IPR041645 all species →	Domain	ADAMTS, cysteine-rich domain 2	Interproscan
IPR001590 all species →	Domain	Peptidase M12B, ADAM/reprolysin	Interproscan
IPR050439 all species →	Family	ADAMTS and ADAMTS-like	Interproscan
IPR013273 all species →	Family	ADAMTS/ADAMTS-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13723 all species →	ADAMTS A DISINTEGRIN AND METALLOPROTEASE WITH THROMBOSPONDIN MOTIFS PROTEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0030198 all species →	Biological Process	extracellular matrix organization	Interproscan
GO:0031012 all species →	Cellular Component	extracellular matrix	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08621	ADAMTS6; a disintegrin and metalloproteinase with thrombospondin motifs 6	EC:3.4.24.-	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025554-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

338.4Max TPM

69.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	92.50	198.78
polyp at pH7 6	18	18	89.46	281.52
coral polyp · control treatment	16	16	52.63	103.09
coral polyp · oil and dispersant treatment	16	16	48.87	125.45
coral polyp · oil treatment	16	16	73.30	196.25
coral polyp · dispersant treatment	16	16	50.05	102.51
Polyp	10	10	71.70	338.39

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	198.78
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	197.92
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	131.72
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	131.21
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	114.28
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	113.35
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	95.56
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	93.14
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.91
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	85.93
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.95
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.55
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.42
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.49
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.01
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.46
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.86
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.46
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	281.52
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	280.46
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	91.20
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	86.59
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	84.57
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	80.74
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	80.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	77.84
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.59
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	67.29
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.63
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.02
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.11
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.58
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.31
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	103.09
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.92
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.36
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.45
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.74
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.04
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.82
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.04
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.61
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.44
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.03
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.49
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.14
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.88
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.53
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.43
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	125.45
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	114.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.71
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.36
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.35
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.37
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.33
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.24
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.83
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.82
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.88
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.95
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.06
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.28
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.02
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	196.25
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	103.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	101.91
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	84.78
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	83.45
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	82.79
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	79.38
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	71.69
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	71.11
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.02
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.70
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.14
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.73
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.37
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.73
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	102.51
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	88.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	86.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.02
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.85
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.06
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.35
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.79
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.67
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.86
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.10
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.41
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.88
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.81
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.48
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	338.39
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	114.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	73.63
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	71.51
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	36.20
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	28.51
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	18.18
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	17.30
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.50
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.38

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.