Gene detail

Detailed information of OS493_025618-T1 in Lophelia pertusa

Genomic Location: scaffold_127:570015...580653
NR annotation: KAJ7390367.1, hypothetical protein OS493_025618 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025618-T1

ATGGCTGTTTTGAAAGCGCAGCTAAACGAGCTGGAGTCGAAACTCGAAGGGAGAGAAGGAGATTCATCTCATTTAGTGAAACAACTAGAGGAAGCAAGACTGGAAGGATCCAAAGCTTTGAGGACTTTGAGGGATACAGAAAATAATTTGACTGTATCCAAAAAACGCTGCGAGGAGCAAGAGACAGAAATCGCCCGACAATCAAATGTGTACAAATCTGCATCTATAGACATTGCCATTGCTGGGTTAAAAGTAGCAAACTTGCAAATCAGCAAGCTTGATGCAACAAAGTTATCTCAAGATACAACTATCAAGGACTTGAAAACCAGTATAACCAGTTTGCAAAGTAAACTGAACAAGCTTGAGAGTGAGCATGATGACTTGGGGAAGAAGTTTAGTTCTCGCACAGTGCAATCTGATTCTGAGGTTAAACGACTTCAACAGGAAATCGAGAAACTCTCAAGGGAAAAAGCCGACTTGGAATCAAAATATAATGCTGAGTTAAAAAGAGCCACTGAACAGTCTTCCAGTAAGGAATCATCACTGAGAAAAGAACTAGAAGAAGTTACGGCAAAGCTAAAGCGAGATCATAGCAAGGAACTAGAGGAAACAAAGTCAAAACTCGGCAATGATCATAATAGCCGCATGAAGACTTTACAGCAAGAATTTCAGGAGAAATTATCAAAGCAGGAGAGGGATCTTTTAGAAAAGTCAGAGCAAGAACTTGAGAGATTGCGCGTGGAGAAAAATGACGTCATCGCCCAGTATGAGAATCATTGTAGTGATTTGAAAAATAAGTTAAAGTCTTCTGAAGAAGAAGCAGAGAGGCTAGAGAAACTGGTTCATGATAGTGAGAAAGGACTTGGATCTGCATCATCGCATATTGACAGCCTGAAAAAGGCGCTTAGTCAGACGAAAGAGGAGTTACAGAAAACCAAGAATGACTTAAAGGAAGCTGAGAGCAAGTATACTAAGGCAATGGATGATATGTACAAGCTTCAAGCGCTCCACGACAAAGCATTGAAGAATGGTGCCATAGATTTGAATGCTCGGCTAGAATCACTGACAAATGAGCTGGATACGAAGTGGAGTGAGAGATTAAGGGATGAATGCAGTAAACTACGCTCACAGCTCAATGAACAACACAGAGAAGAAAACAGAGTATCGCTAGAGGAGCTGACAAAGATGAAAGACTTTCAGAGAGATGAACTCCGAGCAGAGCTGCAGAGTAAAATTGATGCTCTGAAGAAAACTATTGTTGAAGCCCGAAGTGATTTGGAAAAGGCAAACCGTAGTGCCACGACAGCTGAGCTTGATCTACGCAAAGACCTTGACATGCAGAGGCGACATATGGAGGAAGAAATGGCTGCCTTGTCTCTTCAACATAGCAAACGACTTGAAGAGCTGATAGAACAGCACAAGGAGGAGTTGAGGAAACTTGAAGGGTTAAAAGATGAAGAAATAAAGGAACGCGAGAGCCAGCTACAGAAGAGTCACAGAGATGAGATCACTTCCCAGCTTCAGGCAAACAAACTTATGATAGATGCCGTCAAATCCCAAGCTGAACAGAAAAGAGCGAAAGACATTGAAGAAATGACAATTCAACATGAAAATGATCAAGAAAATATGAGGAGTGAACTCCTGCGAGTCCAACAGGAAGAAATGCAAAGACTACACAGGGAATTTGAGGTTCAACTAGCAGCCATGAAACTTCAACTACAACGAACCAATGAATTGCACTCCAGAGATGAAACTGAACACCAGAGTCAAATAGAGGAGTTAAAAGAGGAGATAGAACAAAGACAGTATCAGATTAAAGAACTGGATGAGGAAATTGGCCAGGCCAAAAACAATGTGGGTGAACTTCAGCGTGAATTGCAAGCCAAAGGGCAGGAAATATTAAGTGTCCGACGAGAGGCTAACTCACAAATCAGGAAGCGTGAAGAAGATCTGGCTAAAGCACACCAGAAGGAGGTGGACTCTGTTACTGCACATCATCTGCGTGAGACTCAAGCCCTGCTGACAGAGTTTAACAGAGCCAAAGAACTTCTTAGTGACAAGATTTCTGCTTTGCAATTAATGTTGGAGGAAGCTGAAGATAAATACAGAAGCCGACAGTCGCGCCCAGAGGACTTGGAAATCATTGAACAGCTCAAGAGAGCACTGGTAGAGAGAGAACTGGACATGAAGAAACTTGTGGATGAAAAGAGATATTTTCAATTGGAGCTGCTCAACAGAGAGACCAATTTCAACAAGGTTTTCAAAACAACACCAAGCATTGGCGTGATAAACCCACTCCAGGCAAAAACAAAACCAGGAAAGGAAGGAATGCGGCATAGCAGTTCACTTGTTATGAGCTCATCAAGGCTCAATCCAATCCCAAACATGCCAGTACACGAGAAGAAACTGAATAACAGCCGGCCGCTGCCGCCCACCCCGCCCAAAGATCCTCCCCCACACAGAAAAACTACTGTATACTAA

Transcript

OS493_025618-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NB25	Protein FAM184A OS=Homo sapiens OX=9606 GN=FAM184A PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004576 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_025618-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

No InterPro signature was detected for OS493_025618-T1. This gene does have a gene model — the search simply returned no hit.

PANTHER

PANTHER term	Description	Source
PTHR18870 all species →	PROTEIN TAG-278-RELATED	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_025618-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_025618-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025618-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

74.2Max TPM

20.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.98	33.20
polyp at pH7 6	18	18	18.30	25.07
coral polyp · control treatment	16	16	24.45	69.33
coral polyp · oil and dispersant treatment	16	16	23.78	74.16
coral polyp · oil treatment	16	16	22.16	28.07
coral polyp · dispersant treatment	16	16	19.91	34.92
Polyp	10	10	16.94	22.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.20
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.35
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.57
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.52
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.99
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.89
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.41
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.17
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.97
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.18
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.01
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.83
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.64
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.23
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.29
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.36
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.07
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.29
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.49
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.17
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.58
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.48
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.37
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.09
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.93
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.62
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.60
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.95
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.35
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.11
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.40
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.33
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.55
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.65
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.63
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.36
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.43
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.31
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.74
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.71
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.16
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.52
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.59
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.15
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.17
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.66
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.06
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.82
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.05
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.83
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.32
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.03
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.89
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.07
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.44
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.27
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.34
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.35
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.31
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.29
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.51
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.73
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.59
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.43
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.95
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.91
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.92
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.36
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.23
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.19
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.21
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.38
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.52
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.38
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.87
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.57
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.53
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.10
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.09
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.63
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.58
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	22.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	22.69
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	22.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	21.69
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	20.13
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	16.04
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	14.40
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.19
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.84

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.