Gene detail

Detailed information of OS493_025816-T1 in Lophelia pertusa

Genomic Location: scaffold_129:924150...956507
NR annotation: KAJ7377921.1, hypothetical protein OS493_025816 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025816-T1

ATGGCGACGGCAGTATTCACTTCCCGGCCTAATTCCCACCCATTTGAAGAGAGAAGAGTCCCTTTAACGGAACCAGTGAAGATAGGACGTTCAGTAGCCAAGAGCAGACCCGCTACAAACAATTGTATCTTCGACTGCAAAGTGCTGTCCCGAAACCATGCGATCTTGTGGTATGAAGATGAGAAGTTTTACTTACAAGATACTAAAAGTAGCAATGGAACTTTTGTAAATAATGTGCGTCTCAGTAAAGGCTCAGAAGAGAGTGAACCTAAAGAGATTAAATCTGGTGATATTGTGCAGTTTGGAGTGGATGTAGTGGAAAACTCGAAAAAAGTTACCCATGGCTGTATTGTTGCCACGGTCACCCTGTTCCTCCCTGATGGAAAAGAGGCAACAAAAAGTGGTGTTCCAAGAAGCTTGTTTGCTTTGAATGAAAATGGCATTCAAGCACAAGAAATGTGGCAGTTGTCCCAGTACTTACAGGATGCATTGTACAGAGAGCAAATGCTTGAAAACAAACTGGCAAATCTTCAGAGACTTTTATCAGACTCACAACTAGCTGTGGAAGATAACTCTCAGGCAATCGCTCAAGAAGACAAATTACTGTCAAGATTAGAGACTTTAGAAAACCAGTTAGAAACTCTAACAAAGAATTTAAATGAAGATGACATCAAAAAGGAGTTACTTGTTCTCCAGGAGGAGAGACATCATTATGAAATGAGAGCAAAGGAGTCGTTGAAAAAAGTTTTACAGGAAAAACTGGAGGCAATCCAAAAATTAACCGAAATAGAGAAATCCTGTAACAATGCTGAGGATGACTGTTTACATTACAAATCGTTATATGAGCGATCGCAGCATGAACTGAAAGACTTGGCTGAAAAACACAAGCAGAGGTTACAAGAGATGCAGAGTCTTCAAGATCAAGTTGAAGAAGCAGAAAGTAGACACTCGACAGTTGAAGGCCAGGCTGTTCAAGAGAAAACAGAATTTGAAACAAGAATTAAAGAAGCACATCTTCGTGAGGCTGCATTAGCTGCTAAGGCAGAATCTTTGCAAGCAGAATGTGACTTTACAAAAGAACAGGTTGCAGCAATGAAAGTTCACATGGAAAAAACTAAAGATGAACATCGTCAGCCAAATAATGAATACAAAACACCTGTCATCCAGCTGCAAGATGAGTCTGTCATAGAAGCTGTAGATGTCAATGGAACGAGAGAACTGGAAAAGCTGCCAGATAGTTTTGATGAAAATACAAGGCAACTGGACAATCCAGGGGACAGTGATTACTCCAATACAGATGATGTGAAGATTTTACAAGTACAAGTTGAAAGACTTCAAGGTGAAGTTGGAGATAAGGAGAAGATTCTGAATTCACTTCTAGAGCAAATAGAAGAAACAAGATTGTTACATAAAGAAAGCCAAAATGATATAGTGCTCTTGAAAGAACAATTAGAAAAGTCACAGCTAACTGCACTGGATGACAAGGAGAAGATCCATTCACTGGAAGAACAAGTGATGGTGTATCATCTGCAAGCAATTGATGAGTTGTCTATTCCAAATGATAGCGACGCTGAAGAAGGAGACCATATTGATGCAGCTCAGCCTGTTATCAATCATGATGAGCATGTATTGGATAAGTTAGACGGAAGGATCTTGTTTGATGAGATGGATCTTGTTAAGCGGCTCCATGATCGCATTTGTGAAGTAAAGACCATGGCTGAGGAAAGACACTTGATGATGATCAGATGGTCTGCTGATGATGATGATGACGATGATGATGAAATAGTTGCCAATAGCAACAGCAGCGAAAAATCTCACCACGATGACAGCCCAGTTCATCAACCACGAAATGCAAGGCAATTATTACAGGACAGCTTGCACAATGTACAAGACATTAAAGGAGAATTCATTGAAATTGGCAGAATTATCGACAATGAACATGAAGAGTCACAACATGTGCAAGGACAACTGAATGACACCCAACAAGAACTCAAGGAAAATAATGAGCTTGTGGTAGAGTTACAAGAGGAGCTGAAAAATGCCCAGACCTACACTAAAGACTTCAAACAGCAAATTTTAGACCTGAGAGATAAATTACTAGAAGAACAAGAGTCTACCCGAAAGAAAGAGGAATTTGTGGCCCAGTTAAAAAGAGAACTGAATGAATTGATTCGAGAAAAAGATCTTCTCGCGTTGGAAAAGAAGTGTGAACATCACGCCACTGAAACCGCCATGAACAACGCTCGCGAGATGCAGAAACAGGCGGCCAAGAGCGCGAAGGATGCTGGCAAAAATAAAGTGGAACTTAGTGCAGTCACAGAAGATAATCGCTTCTTAAAACAACGAATACAGATCCTGGAGAGCGAACTGAAAAAATATCGGAGGGAAAACAACCGCTTGTCCTCCGACCAGTCTCGGCTCCAGGCCACCTACCGTGAGATCGAAAACCAGAGCAAATTTTTAAGTGAAAAAATCATGCGACAACAGACAACGCTACAGGGCAAGATCGAGAGGGAAATATCCGAGAAAAAACTCACCGAAGATCAGGCTAACGCTCTTGAAGAACGACTTCATGAAACTGAAGTGGATCTTAAAAATAAGCAGGAGGAAGCACACAGGAATATACAACAACTAAATGACTCCAATTCTCAACTGTGGACGTACATAATGGCGGGGATAGTGGCATTTATAGCGTTCATTGTAGCGTTTGTCCTCGATCTTATTGAACTACACCCTGGTGGGCGGACACGTGGTCTTTGGAGTTAA

Transcript

OS493_025816-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q28623	Sarcolemmal membrane-associated protein OS=Oryctolagus cuniculus OX=9986 GN=SLMAP PE=1 SV=2
Q14BN4	Sarcolemmal membrane-associated protein OS=Homo sapiens OX=9606 GN=SLMAP PE=1 SV=1
Q3URD3	Sarcolemmal membrane-associated protein OS=Mus musculus OX=10090 GN=Slmap PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002401 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00498 all species →	FHA	FHA domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000253 all species →	Domain	Forkhead-associated (FHA) domain	Interproscan
IPR008984 all species →	Homologous_superfamily	SMAD/FHA domain superfamily	Interproscan
IPR051176 all species →	Family	Centrosomal and Immune Signaling Modulators	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15715 all species →	CENTROSOMAL PROTEIN OF 170 KDA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_025816-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025816-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

77.2Max TPM

16.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.14	22.50
polyp at pH7 6	18	18	14.08	18.49
coral polyp · control treatment	16	16	22.84	77.22
coral polyp · oil and dispersant treatment	16	16	20.52	60.58
coral polyp · oil treatment	16	16	16.84	22.34
coral polyp · dispersant treatment	16	16	14.69	22.37
Polyp	10	10	9.98	19.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.50
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.58
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.51
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.56
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.50
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.99
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.97
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.71
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.62
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.16
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.60
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.44
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.09
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.42
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.85
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.70
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.55
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.71
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.49
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.36
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.20
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.97
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.40
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.35
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.07
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.37
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.72
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.58
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.13
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.35
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.94
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.87
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.89
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	77.22
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.56
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.11
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.66
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.08
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.32
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.41
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.17
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.82
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.49
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.42
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.71
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.40
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.06
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.58
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.82
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.76
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.33
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.36
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.27
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.05
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.97
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.84
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.28
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.86
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.13
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.59
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.33
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.34
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.70
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.34
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.57
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.57
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.29
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.05
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.70
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.77
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.87
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.42
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.94
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.79
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.09
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.89
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.77
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.82
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.50
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.72
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.44
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.33
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.24
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.66
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.59
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.07
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.89
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	19.37
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.36
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.98
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.02
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.03
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.35
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.19
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.69
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.11

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.