Gene detail

Detailed information of OS493_025942-T1 in Lophelia pertusa

Genomic Location: scaffold_131:161008...174152
NR annotation: KAJ7356191.1, Dynein light chain Tctex-type [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025942-T1

ATGGCCATGGCGTTGTCGGATGGCGTTAATACTACTGGGGAGAACAGGCGCAGAATCCTACGACGATTCTTGGTTCGTAAGAACAAGAAGGACACGATCAAAGAATTAGAAGCCCTTGAGGCATGCTACTGGCTAAAAGCTGCAGGATTTCCACAATATTCACAGGCCTATGAAGATGGAAAGTTTCCAATTGACACAGCATCTGTCATTAAGGAACATGACTTCCTGGATCAAGATTCCATTCAATCCTTGTACAGGCGTCTTCAAACACTTAATCGGTGTGCAAAAATGAACCTTCACATCAAGAGTGAAGGTTATGACTCTGATGAAGAAGACTTGATTGCGTTAAGTTCGCGTTGGAAACTTCAAAATAAAAATCGTCGGTGGTCAAGCCGAAGGAATGGTTCACCTTCACTCAAGAAGGACAAGTCAGCAAGTTTAAGTAGCTCACATAATGGAATAAATTCGTCTTTGAACAGTGTAACAAATACAAGGCAAAGATCTTTCCACAAGAAAGACAGACTTGTACCTGACCAATTGTCACCTTTTACACACTTGGATTTATGCATAGCACAGGGGAGAGCAAGTGTATATGACAATTTGTCACCAGCATTGAGTGTCAGTACACCTTCAATATCAAATGTTGGCAAAGACCTCAACAAGAATGATGAACTAAGAAATGCAAATAGAACTCAAAAACGAAATCTCACTAGCAGTGATTTGGGACTAGAATCTTGTAGTGCATCATCAAACGAGGAGCTATCAGACTTTGAACGCGATGATGAAATTGATGATTTACCAGGGGATTTGTCAATGTTACGGTCAATCAGAAATTCAGAGAGACAATGCAACAATGATATGGCACCATCATCAAGGGTAACAAGGCCGAAAGTACGGTGGCACAGCTTTGAGAAATCTTCTAAACCTGAAATACGTGTTGCGTCACCAAAAATCTGCGACCTCACAGCTGGACAACTGGCTGTTCTCAGAAAATATTCACTTTTGAAACTTACGGCATTAATGGAAAGACACACTCACTCACACAGAGGCATGTGGAATTGGTCTTTTCCTCATTTCTTAAAGAAGCTCAAGTCACCAGATTATAGAGACAGGAATGTGTTTGGAGTTCCCCTTTCAGTTGTCTTGCAGAGGACAGGTCAACCCCTTCCACAATCAATACTCTTTGCAATCAATTACCTCCAAAGATCAGCTGTGGATGCTGTTGGCATATTCAGAAAATCAGGTGGTAAACAGAGAATAAATCATCTCAAGGAGATGATTGAAGGAGATCCAGATAATACTGACTTTGAGGGCCTGTCACCCTATGACATGGCTGACATGCTGAAGCAATACTTCAGAGAACTTCCAGACCCTATCTTGACGTCAAAACTAGCAGAAACATTCATAACTATTTTCTCAAGTATTCCATCTGACTCCAGGATGGAAGCAATGCAAGCAGCAATCCTTCTAATGCCTGATCCAAATAGAGAAGCACTGCAGACACTTCTGCTGTTCTTAAATGAAGTGGCTGCCAATTCTGAAACAAATCAGATGAATGAGAAGAATCTGGGAGTATGCTTTGCTCCATCGCTTTTCCATTTGTGTGGCACCAAAGAGGATCCATCATCTCCTAAACGGCAAAAGAGAACGCCCATGAACAAAGCTTCCAAGGAACTCACTGATAACTTGGCTGCCCACGAATGTTTGGCTCAGATGATAACAGAAGTTGACAAGCTCTTCTCGATTCCTGAAGACACGGTGAAGAACAGTCGGTTTTCATACATCGAGAAAGGCGAGCCGGTTTCTCTAGATCAACTGGGAAAATCCAAATCCAGTCCTCAAAGTGGTTATCAGACGTACATTGAGTCGTGTATCGCTGGACTGCTCAAGGAAGCAAAAGACAAATTCAAGGGCTGGGTATCTCAGCCATGGTACGACGGTTCGGTAGAGATCTCCTACAAGAAGGTCAAAGATGGCTACCCTCTTAGATTGTGGAGATGTGTTGTGGAAGTAAATGCTAGTCCTGATGATGTGATCAGAAGAATTCTTTACGAAAGGCATCTCTGGGATGAAGACTTGGAATCGTGGGATATGATCGAGAAAATCGATGATAACACGGACGTGTTCTTTTACACCACAAAATCCATGATTCTTCAGCCAAATCGGCAACACGTGGTGCTCAGGTCATGGACGGACCTCGATCGGGGTGTCTCTGCCCTTGTGTCCACATCTATTAATCACCCCCGAGCCCCTCCTAGCAATGGAGTGCCTTCTATTGTACTTGCATCAAGATACCTTGTGGAGCCTTTAGAGAACGGAAAATCACGGCTGACGCATATAAGCCGAGTGGATCAAAGGGGTAGAACACCAGAGTACTACAGCAAAGCCATTGGACCATTCTTGGCTTCATCAGTGGCCAAGGTACGGGACACTTTTCAATACGGATCGGATGGCCCTGAAACAAAAGTATAG

Transcript

OS493_025942-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A7E300	Rho GTPase-activating protein 7 OS=Bos taurus OX=9913 GN=DLC1 PE=2 SV=1
Q923Q2	StAR-related lipid transfer protein 13 OS=Mus musculus OX=10090 GN=Stard13 PE=1 SV=5
Q9Y3M8	StAR-related lipid transfer protein 13 OS=Homo sapiens OX=9606 GN=STARD13 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001725 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01852 all species →	START	START domain	Domain	Interproscan
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR023393 all species →	Homologous_superfamily	START-like domain superfamily	Interproscan
IPR002913 all species →	Domain	START domain	Interproscan
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12659 all species →	RHO-TYPE GTPASE ACTIVATING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008289 all species →	Molecular Function	lipid binding	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0035023 all species →	Biological Process	regulation of Rho protein signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20632	DLC; deleted in liver cancer protein	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025942-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

152.8Max TPM

33.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.91	35.18
polyp at pH7 6	18	18	20.28	33.23
coral polyp · control treatment	16	16	29.97	89.48
coral polyp · oil and dispersant treatment	16	16	47.94	105.12
coral polyp · oil treatment	16	16	27.40	71.04
coral polyp · dispersant treatment	16	16	69.78	152.81
Polyp	10	10	18.30	35.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.18
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.79
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.95
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.18
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.40
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.44
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.09
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.70
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.13
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.71
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.99
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.72
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.19
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.57
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.47
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.54
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.58
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.23
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.72
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.77
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.50
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.38
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.26
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.97
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.21
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.08
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.95
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.74
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.60
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.51
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.12
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.18
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.32
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	89.48
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.92
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.12
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.56
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.52
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.39
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.19
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.08
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.77
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.24
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.80
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.53
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.26
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.63
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.13
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	105.12
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	94.91
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	84.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.41
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.94
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.43
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.97
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.63
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.96
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.04
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.75
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.61
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.32
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.12
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.76
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.84
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	71.04
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.07
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.62
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.81
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.20
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.09
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.16
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.50
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.88
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.67
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.37
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.71
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.34
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.98
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.31
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.71
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	152.81
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	118.55
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	115.01
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	91.28
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	88.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	85.91
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.95
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	71.51
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.50
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.19
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.11
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.72
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.26
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	35.69
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	23.52
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	22.77
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	20.73
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.11
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	16.04
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.93
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.27
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.71
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.28

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.