Gene detail

Detailed information of OS493_025964-T1 in Lophelia pertusa

Genomic Location: scaffold_131:350021...357423
NR annotation: KAJ7356212.1, hypothetical protein OS493_025964 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_025964-T1

ATGAAATTTCTCAAGCTTCTACATCTGAGTTTGTTGGCAACCTTCTTGGTTCTCTACTCTCAAGGAGAAACAGCGATTTTAAAGCCAATATGTGGCGTGGACGATTCAAAAGAAGACCGTCCAAAGAGTCCAGCTTCTCCGTATGTTCCTGAGGTTGAAAGCATCCTTATACAGAACGCTATACAGAGACAAGACATAGATGCTTATAACGCCTTGTTCAACAGCAAAATGAAATGCAAAGAACAGTACCTTGTGCCCATAGCCTGGCACGTGATATACGACTCACAAGGGAGGGGTAATGTGTCAGACGCCATGCTGGAGGATCAAGTTAGAGTCCTGAACAAGGCTTTCTCTGACTCGCCATTCCGGTTTGTAACGCTTTCCGTGGACAGAACAAATAACGAGGATTGGTTCAATAACTGTCGCCTCAAGCGATACTTCATAAGAAGGGCTCTGGGAATCTCGCCTGCAACAACACTTAACATATACACGTGTCAGTTCAGGAATCCAGCGATGATCGGTGATGCTACATGGCCATGGCGTGATCGTGAGTCGAGTACATCACACGGCGTGGCTGTTCATTACAACACATTACCTGGAGGCGGGATGGTAACACTTAACCTTGGAGACAATGCTGTTCACGAGATCGGTCATTACTTTGGTCTTTTTCACGTCTGTGAGGGCGGTTGTAATGAAGAAGATGATGAAGTCTCGGACACTCCGCGCTGTGCCGATTACACGTATGTCTGTACCGACCAATCAGTGGACTCCTGTAAATCTCATAGTGGACTGGATCCAATTCACAATTACATGGGCTACATGGAAGATGCCTGCATGTACGAATTTACACCAGGGCAGATAACCAAAATGGAACAAAACGTGAAAAAGTACAGACCTACCCTGATGAAAAATATCTATAGACCCTGTACTATTGACGCTGTTTTCCGCTGGTCAAACGGGCTCGTCTACTTTTTCCTGGGATCGAATTACTACCGCTACAACGAGAATACTCCTGGCTTAGACCCAGGCTTCCCTCGTGCAATCAGCGACCACTGGAAGGGTGTCCCTTCTTCTATAAACGGCGTCTTTCGATACACCAATGGTCTGACTTACTTCTTCAAGGGAAACCAGTATTACAGGTTTAACGATACATCGCTGAGTGTGGATACAGGTTATCCTCGGCTCATAAGTGACTACTGGGTCGGCGTGCCAAATGATATAGATGACGTCATCAGCTACTCGAATGGTTTCACGTACTTCTTCAAAGGAACGCAATACTACAGGTTCAACCCACGCACCCAAAGTGTGGACCCAGGCTATCCGCACTCTGTGAGCTCCTACTGGAAAGGGGTCCCAAGTAACATGGAAGGTGCCTTACCGTGGTACAATGGAGGCGTTTATGTGTTTAAGGATACACAAAATTGGTTATTTTTACACGGCGATCAATCCACAAGTGTTCCCTCCAGCTACCCCAAGTCAATAACACAATGGTGGAGCAGTGAGCCTGATCTAACTGGCTATACGGCGTTTAGACACCTGAACGGCTACACGTTCTTCTTCAAAGGCAACAGCTATTGGCGTTATAATGATCAGTCTTACCAAGTGGAAATCGGATATCCGCGCGCTCTGGCAGCCTGGGGAGGAGTACCGGCGGATGTGGACGCAGCTTTCCTCTGGAGTGATGGATTTGCGTATTTCTTTAAAGGAAAACTTTACTTCCGGTACGATAGCGGCCAAGAAAAAGTCCAAGATGGATATCCGCGCGACATAAGCTCGTTTTGGAAAGGAATACCCGATAGTGTGGATGCAGCCTTCAGATACACCAACGGTATCACGTACTTCTTCAAAGGCTCGCATTACTATCGCTTCAACGATACTACTGAGGCAGTTGACCCAGGCTACCCACGGACGATAGCCTCGTTTTGGAAAGGCGTTCCGGATAACCTCGATACTGTGTTGTCCGCGCGCAATGGTCACACGTACTTCTTCAAGGAAAACCTGTTTTACCGGTTTAACCATACAGCAGGGCAGGTCGACGCGGGATACCCTAAAACGATAGTCTTGTGGAGGGAATACTTCAACAGCCTTAAAAAGAAAATAAATCGATTGAATAACCCATTGGGTGTAAAAATAAATCTCAAAAGTTCATGTTAG

Transcript

OS493_025964-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A4RGT4	Extracellular metalloprotease MGG_08041 OS=Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) OX=242507 GN=MGG_08041 PE=3 SV=1
C9SSK8	Extracellular metalloprotease VDBG_07883 OS=Verticillium alfalfae (strain VaMs.102 / ATCC MYA-4576 / FGSC 10136) OX=526221 GN=VDBG_07883 PE=3 SV=1
C4K014	Extracellular metalloprotease UREG_07765 OS=Uncinocarpus reesii (strain UAMH 1704) OX=336963 GN=UREG_07765 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010105 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05572 all species →	Peptidase_M43	Pregnancy-associated plasma protein-A	Family	Interproscan
PF00045 all species →	Hemopexin	Hemopexin	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036375 all species →	Homologous_superfamily	Hemopexin-like domain superfamily	Interproscan
IPR018487 all species →	Repeat	Hemopexin-like repeats	Interproscan
IPR018486 all species →	Conserved_site	Hemopexin, conserved site	Interproscan
IPR008754 all species →	Domain	Peptidase M43, pregnancy-associated plasma-A	Interproscan
IPR000585 all species →	Domain	Hemopexin-like domain	Interproscan
IPR024079 all species →	Homologous_superfamily	Metallopeptidase, catalytic domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47466 all species →	-	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008237 all species →	Molecular Function	metallopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K07763	MMP14; matrix metalloproteinase-14 (membrane-inserted)	EC:3.4.24.80	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_025964-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

19.4Max TPM

7.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.85	19.15
polyp at pH7 6	18	18	8.20	18.58
coral polyp · control treatment	16	16	6.53	13.68
coral polyp · oil and dispersant treatment	16	16	6.56	13.07
coral polyp · oil treatment	16	16	9.89	18.14
coral polyp · dispersant treatment	16	16	4.98	13.48
Polyp	10	9	5.21	19.37

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.15
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.80
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.44
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.05
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.41
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.07
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.83
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.08
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.54
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.06
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.33
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.23
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.15
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.58
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.40
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.63
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.54
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.38
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.33
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.57
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.52
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.35
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.70
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.29
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.77
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.22
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.98
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.30
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.70
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.58
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.68
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.20
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.59
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.22
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.21
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.58
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.37
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.29
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.35
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.79
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.48
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.26
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.23
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.52
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.73
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.07
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.35
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.35
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.59
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.46
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.60
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.35
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.52
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.36
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.02
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.47
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.42
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.86
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.48
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.14
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.05
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.80
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.53
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.48
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.07
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.85
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.53
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.84
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.08
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.79
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.38
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.33
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.52
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.00
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.48
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.34
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.53
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.57
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.07
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.80
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.48
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.57
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.52
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.25
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.20
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.18
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.90
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.22
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.37
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.88
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.70
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.81
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.74
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.71
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.71
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.