Gene detail

Detailed information of OS493_026122-T1 in Lophelia pertusa

Genomic Location: scaffold_133:140109...157393
NR annotation: KAJ7390254.1, Sarcoma antigen 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026122-T1

ATGAACCAGAGAACTTCCATAGGCACTACGTTGCTTGACGTCGCGAAAAACGCCGTGGAAACCTTTACAAAGCTTCGTCAACGAGATCAGGCGAGTCGAACTGATCGTTACATGTTGGTGACGTTGGAGGAGCCGCCAGGAGCAATAAAGGCTGGTTGGCGGGAAACTCAAGCAACATTCATAAATGAACTAAAGAATCTTCAAGCGACTGGTCTGTCAACGTTAGGGTCTTCTTTGAAAGAAGCATTTGATCTGTTGAATTTGTATCGCCTGCATTCTGGAATAGACAACTACGGAATGGGGCGAAATCCTTTTTATGTGGAACCAGCAATGGTTATTTGTATAAGTGATGGAAGCAAACTTTCTTGTCAAGGTGGAATACAGGAAGAGCTTCATTTGCCCATGCACACGACCTTACCAGGACATGAGCTAACCACAGAGCCATTTCGATGGGATCAGCGATTGTTTTCCATCATACTACGCATGCCTGGAACAAGGAGTGCCATGCCAGTAAAGATGGGAATGCACAACAACGATCCTGCTATTGCTGCAATGTGTGAAGTAACAGGAGGGCGATGTTACAAGGTTACTTCATCAAAGTCCTTGGGACAAGCATTAGAGTCTCTTGCACAGAAAGTCCAGTGCGGCGTGGTGATCAACTTTGAAAAGATTGGAGGAGCTAGTAATCCCCCACCCCCACCCCCTGAAGTTTTAAAGAACAATAGTACCGATGCACGTGAGACAGAGTCTCCAACGCCTCCCCTCTTGGTCCATAACCATGTCATGAACAATGTGGACTATGCCAAAGATGAGGTAAAGGACAAGAACTCATTCAATAATGACGAAAATCATGTACCTGTGAAGTTGGAAGGGTCATTGGCAAGAGGTCAACAGATGGGAGAGAATATTCCCCCAGTAGCTCCAAACAGCCCCCAGTCTGATGAAACTCTTGGTGTTATGGGGATGTCAAGATCAACCACATGCTCTCCAGTACCGCCAAGCGTGCAATCTACTGCATGGATAAGTTGTCGCAGGATGATCTATATCAAAACCTCTCCACCATCAGGACATTGGCCAGTTCCAGAAGCATTCTGGCCGGATCCTTCAATTCAAACAATGCCTTCAAGAGGTGCCCACCCCTGTGTGCTGTTTTCATGCAATAATTCCGAGCCTTTGGTTCTTGACAACTTACCATTTGACAAGTATGAGCTGGAACCATCACCGCTTACGCAATATATCCTGGAGAGAAAATCACCATCGACCTGCTGGCAGACATTCATTTTAAACAGTTGCAAGAAGCTTGGTGACGTGGGATTCCCGTTTGGTTACCTGAAAGCAAGCACAAATCTCCAAACAGTGAATTTGTTTGTTATGCCATACAATTTTCCAGCACTCTTTCCTGTTATAGATGAATTGGTGAAAGTTCACAAGATGAAACCAAGTCCAAAGTGGAAAGAGAAATTTGAAAGCTATCTTTCAACAATGCCAAACTACTATGCAGGGCCTCTTCGCAACGCATTTCGTCGTATGGGCATTCCACCCTCTTTTGTTCCAGACCACTTGGACTCTGTCCTAAGTTATACAGTTGGGAATTATCTCAAGAAAATTAAGCAGCAGAGTAAAATAGAGACTGATAGACTGATTTCCCTTGTTGGCAAAAACCCTGCTAGAGAAACTGTCACAAGGCCGCTCCAAAGTGTACGGATACACCAGCTACCTAAAGCCAAGAAAAAGGACTTCCGTGCATTACTGCACAATAGCAACTTTTCTTCCGGCACTGATGATAACCGAGTATCAAGTGAGACTGACATCAACATTACAAATGCCTCACTTCATAATGTTAAACAGAATGTCAGAACACAAAGCTACAAGAATCCATTTGATGTTTCAAGAGAAGAGCTCTTAGATCAGGTATCTAGGATGAGAATCAACTTTTTTCACACAGCGGCAACATCAACCAGACTGCAAGATGAAGATGCTCGTCACAGTGTGGCAATTGCAGATATGGGTAATTATCAAGAGGTGTTGAGACAAATGAGTCCCTTGCGTGAAGTTGATCCAGGACAGAACAGAGTGCACATGTTTGGAAACCCTTTTAAACTGGCCAAAGATCAGCGAGTCATGGTCGATGAGGCAGATGTAAATGAAGCCATGGCAGGTCCTCCCTCGCGTAAAAGACCTCCTATTGACAACAGGCCCGGCTCTCCTAGGGACAGAAAGAGACCACAGGAGACACCACCTGTACGGTGGCCCAATAAAATAAACCAAAACCAAAATGGAGGAAATCCACTCGCGGTCCCGCTCAACAACAAAGTGCCACCTGACAAAAACTTGTTGTCCCAGGATGCAAAAGTAAACAATGTCTTTCCTGGTCATCACGGGTTCAAACGGAAACATAGTGAAGGAAACGATGGTCTGCACAAGTCAGTGAAGTCATCTAAAGGTTTAATTAAAGGTTCACAACTTGCGAGACTTCAGCGACTTCAAAACAAAGGACGGTTAAATAGGAAACATCAACCCGAAGCAAGTAGCGATGTGGTTAATTCTTCCAAGAATGACTTTGTCTCGTCGATCCTCAAAGAGGCAGTGACTTCTCAAACTAGAACGTTCTCAGGCCAAGGGCGGCCTATGCTTCATTCTAATGACAATGCACTTGGTAAAAACAAACTCACAAACTCTGAAACACCAGAGGTGATTGTTATTGACGAAGTTGTAAAAGACCGAGGGAAGGGGCCATCACCGAGATTGCTGAAAAAGCAACTTGCACGAGAAGCTTTGGAAGAAAACAGGCTAATAAGAAACAGCATATTCAAGGAAATCAGGCAACCTGGAAGAAGTGATGAAGTTATCTTGGATCATCTCGGCAACTTAAAAGGCTCACTTGAGGTTCAGAGCTCAGTTGTACAAGAAATCATCGAGGAGGCCGAGCTGTTCAAGAAGAAATCATTGATCGAAAAGCTCTCATCTCACCTCGCAAGCCTTCAAGAAAGACTGTCGCCCACCTCTACTGAGATTTCTACTGAGATTGAACTTTCAAAGAAGAAAAGATAG

Transcript

OS493_026122-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UL03	Integrator complex subunit 6 OS=Homo sapiens OX=9606 GN=INTS6 PE=1 SV=1
Q6PCM2	Integrator complex subunit 6 OS=Mus musculus OX=10090 GN=Ints6 PE=1 SV=1
Q2TAF4	Integrator complex subunit 6-A OS=Xenopus laevis OX=8355 GN=ints6-a PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005536 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13519 all species →	VWA_2	von Willebrand factor type A domain	Domain	Interproscan
PF15300 all species →	INT_SG_DDX_CT_C	INTS6/SAGE1/DDX26B/CT45 C-terminus	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002035 all species →	Domain	von Willebrand factor, type A	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR029307 all species →	Domain	INTS6/SAGE1/DDX26B/CT45, C-terminal	Interproscan
IPR051113 all species →	Family	Integrator complex subunit 6	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12957 all species →	DEAD/H BOX POLYPEPTIDE 26/DICE1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0032039 all species →	Cellular Component	integrator complex	Interproscan
GO:0034472 all species →	Biological Process	snRNA 3'-end processing	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13143	INTS6, DDX26; integrator complex subunit 6	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026122-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

48.1Max TPM

19.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.18	31.68
polyp at pH7 6	18	18	21.16	31.37
coral polyp · control treatment	16	16	20.78	41.60
coral polyp · oil and dispersant treatment	16	16	21.43	48.12
coral polyp · oil treatment	16	16	19.45	29.23
coral polyp · dispersant treatment	16	16	19.96	44.98
Polyp	10	10	8.44	14.27

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.68
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.46
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.28
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.02
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.88
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.81
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.11
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.80
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.16
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.78
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.66
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.25
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.66
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.29
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.27
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.47
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.75
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.37
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.59
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.36
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.97
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.09
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.84
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.20
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.98
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.51
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.48
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.41
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.33
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.77
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.02
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.85
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.14
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.60
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.44
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.78
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.59
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.92
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.63
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.94
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.59
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.29
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.15
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.88
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.09
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.20
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.09
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.83
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.52
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.61
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.39
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.47
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.06
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.66
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.03
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.67
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.67
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.29
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.40
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.81
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.91
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.98
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.58
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.23
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.26
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.09
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.92
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.56
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.60
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.35
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.86
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.74
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.95
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.50
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.03
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.37
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.54
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.37
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.91
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.98
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.26
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.72
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.15
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.49
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.23
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.03
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.62
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.80
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.36
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.04
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.52
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.47
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.09
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.52
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.27
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.76
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.48
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.36
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.35
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.51
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.02
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.69
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.60
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.32

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.