Gene detail

Detailed information of OS493_026175-T1 in Lophelia pertusa

Genomic Location: scaffold_133:672824...687557
NR annotation: KAJ7390300.1, collagen [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026175-T1

ATGGACGGAAATGCTGGACCGAGAGGGGAGACTGGGCAGAAGGGTGAAGGTGGATTCCCAGGACCTGCAGGCGACAGCACAAACGGACCTCCAGGACCGAAGGGTGACAAAGGACAGCCTGGACTTCCGGGAGATGTAGGATCTAAGGGAGTCTTAGGTGAGAAGGGTGAAGTGTGCGGCGAGTGTCCACCACCCCCTAGAGGACCCCCAGGAGATGTTGGTGACATTGGCCCCGCAGGTGAAGATGGAGATGTTGGCCCGCCTGGTGTTACGGGGCCTGAAGGTGATACGGGTGCCACTGGAAGTGATGGACGGAGTGGACGACCAGGAGATGCAGGTAAACAGGGTGAAACTGGTGTCAGTGGCAGTCCTGGTCCCAAAGGTGATAAGGGCGAGGTTATCCGAGTGGTGGGAGCCAAAGGAGAGAAGGGCGGACCAGGTCCTGAGGGATTATCAGGTGAACAAGGTCTGGATGGAAAGCAAGGTGACTTGGGCGAACAAGGGCCGCCTGGAGCTGAAGGGACCAGAGGAAAAAAGGGTGATAGAGGCAATGATGGCTCTAATGGAACTCCTGGATCTAAAGGTGACAGAGGAGAGCAAGGCTTCAAAGGGGAACCTGGACAAGTTTTACCAGGACCCAAAGGAATTGATGGAGTGCCTGGAGCAAAAGGCAAACCAGGAGACATGGGGGATTTAGGCATTAAGGGAGAACCAGAATATGTCGAAGGGCGTCAGAGGAGACAAGGGCAACAAGGCCCTCCAGGGCCAAGCGGCGAACAAGGCCAGAGAGGTCCGGCAGGACAAAAGGGTGCAAATGGAACTACAGGTGCACCAGGGATGAAAGGGGAGGAAGGTGAAGGTACCGAAGGGCCTGCAGGGCCTCCTGGACCACAAGGACAAACCGGTGGGCCTGGAGTAAAAGGTGATAAAGGTATCACAGGCGACAAAGGTATCACAGGGCCCACTGGCCGTAATGGCAGTGATGGTGCTAAAGGTGATAAAGGACCGGTTGGACCAGATGGTACCCCTGGGAAATCTGGAAAACCAGGGGCTAATGGACCTCCAGGGGATAAGGGTGAAAGTGGTCAGAATGGCAAAGATGGTTTACCTGGTGGACCAGGCAAGGAAGGTTCTATAGGGCCGATTGGCATTAAAGGTGATGCAGGCCAGCCAGGGCCGCGTGGATTCCAGGGCGATATTGGTGAGAAGGGTGAAGCTGTTGTTGGTCCCCCTGGCCCCCCTGGAAAGGAAGGACCTCAAGGTCTGCCTGGACTGAAGGGTGAAGCTGGAGTAACTGGTAGAGATGGTGATCCAGGGAAGGATGGGGACACCGGGAGCCGTGGTGACAAAGGAACAACAGGTGTTCAAGGTCCCCTCGGCCCACAGGGGCCAAACGGAAGTAAAGGAGAGGTTGGTGAAGCAGGTGATATTGGAGATCAAGGACTTCCTGGAATCCCAGGGCGCCGTGGGGAAGTAGGTGACAAGGGAAATGATGGGCCAGCAGGTGATTCAGGTTCCAAGGGAGAACCAGGTGTCGAAGGTGGAGTTGGGCCACCAGGGAGAGATGGTTTCCCAGGACTTAAGGGCGTTCGTGGTATGAAAGGTGTACAAGGACCAGCAGGCAAATCAAATGCCACAGTTATACCTGGAGAGAAAGGTGATAAGGGAAGTCCTGGGCCGCCAGGAGAACCAGGAAGAAATGGTGCTGAGGGAAATCCTGGTGCAGCAGGAGATATTGGCCCCGCTGGGGAAGATGGATCCCAGGGGGATCCTGGTTCCCCTGGGATACAAGGTCGACCCGGTGATTCCGGTGCACCAGGTTCCAAAGGTGATCGAGGGATTCAAGGAGCGGCGGGGGCAGGAGGAGTCAAGGGTGAGAGAGGTTCAGATGGACCGCCGGGTGAACCTGGCCCTAGAGGGCAAAATGGAGAACGTGGTAAAGAAGGAAGTAAGGGTGACGCTGGCCTTCCTGGTATTGGTGTCCCTGGTGAACTTGGAGATGTTGGTGCAGACGGAAGTCCAGGAGAAAGAGGCAAAGATGGTGACAAGGGAGAGAGAGGGTCCGATGGGCCGCCCGGCCCTGTTGGACCAATTGGTCCAGCGGGTAAACCAGGTGCTGAAGGTAATAAGGGAGATAGAGGTACCACAGGTGCAACAACAGTTGTACGAGGTCCAAAGGGTGATCAAGGAGCTAATGGAAGTAGTGGACTGGATGGTATGGACGGAAATCCAGGGGAAAGAGGGCCCCCTGGCACGCCGGGAAAGACTGGAGACTTGGGAGATCAAGGTGTGAAAGGTGAGAGGGGAAGTGATGGTGCTCGTGGCGCTCGCGGTGAGGATGGACTTGCAGGAGAGGCTGGACCTCCGGGTCTAAAAGGTGAACAAGGCAAACCCGGTGCTGCGGCGGCCAAGGGAGACACTGGCGTGGAAGGATTCCCAGGGGCCCCAGGTGAAGATGGAGATGTGGGCCCCCCCGGTGAAGTCGGTGCAATTGGCAATCCTGGTCTGAAAGGAGAGCAGGGTCCACCAGGACCTAATGGAAGTCCTGGAGGTGATGGGATAGATGGTGAACCCGGCTCCACTGGTGAACCTGGAACGCCAGGACAGGAAGGTGATAAGGGAGAAGCTGGACCTGTTGGACCAAGCGGACCCCCAGGGATTAAGGGAGACGTGGGAGCCAAGGGTCTTGGAGGTGACCCTGGTGATGAAGGGGTCCCCGGGGAGTCCGGTGCCCTTGGTAAACCTGGTTTAAAGGGCAACGAAGGATTTCCCGGCATTCTTGGCTTGAAAGGAGAGCCTGGAGCCAATGGACAACCAGGAGAAAAGGGTGACCCCGGACTTGGAATGGGCTCTCCCGGCCAGAAAGGCGAGCGCGGTGAGGTTGGTTTAGGGGGTCTTAATGGTGATAAAGGTGACCCAGGCCCCGCGGGTCCAGCAGGTCCCGAGGGTCCTAGAGGAGAAGCTGGTGACCCAGGAGTTAATGGAGCAGACGGACAGAAAGGTGACCCAGGGCTGGATGGAGTGGCAGGTCTCCCCGGGGGGCTTGGTGATCAGGGACTGAAGGGTTTACCGGGTCTTAATGGTCTTCCTGGTCCACCTGGGGAAGCTGATTTTGGGTTCTATGTTGTACGGCACAGCCAAACAGCGCAGCTTCCTGATTGCCCGGGCGATACAGTGTCCCTGTGGGACGGGTACAGCTTGCTTTACGTGCAGGGAAACGAGAGAGCTCATGGCCAAGATTTGGGCCAACCGGGCTCATGTCTTCCTAAATTCAGCACCATGCCCTTCCTGTTTTGTAACCTGAACGAAAACTGCAACCTGGCCTCACGCAATGACTACACCTTCTGGTTATCAACACCCGAGCCTATTCCCATGATGCCTGTTCAAGACCAGGATGTGAAGCCCTTCATTAGCCGCTGTCGCGTGTGCGAGGCACCTGCCATGGTCATGGCGCTTCATAGCCAGAGCATGATCGAACCAGACTGCCCAGAGAATTGGAAACCACTCTGGAGAGGTTACAGCTTCCTCATGCACACGAGCGCAGGCAACGATGGAGCTGGCCAACTTCTTTCGTCCCCAGGCTCCTGTCTGGAGGACTTCCGTACCAGTCCCTTCATAGAATGCCACGGTCGTGGGACATGCCACTACTATGGCAGCACATACAGTTTCTGGCTAACAACCGTCAGCGACGAGGAACAGTTCCGAACACCAACAGCGCGGACTATTAAATCAGGAAACCAGCGCCAGCACGTGAGCCGCTGTACCGTGTGCATGAAAACGGTTTATAACAATGGCAATGGAAACGGGAATGGCGGGAACGGCGGTGAGCCAATCACAGACATTGGTGACTTGCCCAACTAA

Transcript

OS493_026175-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7SIB3	Collagen alpha-2(IV) chain (Fragment) OS=Bos taurus OX=9913 GN=COL4A2 PE=1 SV=1
P02462	Collagen alpha-1(IV) chain OS=Homo sapiens OX=9606 GN=COL4A1 PE=1 SV=4
Q7SIB2	Collagen alpha-1(IV) chain OS=Bos taurus OX=9913 GN=COL4A1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001899 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01391 all species →	Collagen	Collagen triple helix repeat (20 copies)	Repeat	Interproscan
PF01413 all species →	C4	C-terminal tandem repeated domain in type 4 procollagen	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008160 all species →	Repeat	Collagen triple helix repeat	Interproscan
IPR016187 all species →	Homologous_superfamily	C-type lectin fold	Interproscan
IPR001442 all species →	Domain	Collagen IV, non-collagenous	Interproscan
IPR036954 all species →	Homologous_superfamily	Collagen IV, non-collagenous domain superfamily	Interproscan
IPR050149 all species →	Family	Collagen superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24023 all species →	COLLAGEN ALPHA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005201 all species →	Molecular Function	extracellular matrix structural constituent	Interproscan
GO:0005581 all species →	Cellular Component	collagen trimer	Interproscan
GO:0005604 all species →	Cellular Component	basement membrane	Interproscan
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan
GO:0030020 all species →	Molecular Function	extracellular matrix structural constituent conferring tensile strength	Interproscan
GO:0030198 all species →	Biological Process	extracellular matrix organization	Interproscan
GO:0031012 all species →	Cellular Component	extracellular matrix	Interproscan
GO:0062023 all species →	Cellular Component	collagen-containing extracellular matrix	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026175-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026175-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

246.1Max TPM

41.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	32.09	66.49
polyp at pH7 6	18	18	33.72	56.99
coral polyp · control treatment	16	16	63.55	232.78
coral polyp · oil and dispersant treatment	16	16	46.40	167.86
coral polyp · oil treatment	16	16	49.11	246.05
coral polyp · dispersant treatment	16	16	44.54	138.99
Polyp	10	10	6.93	14.22

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.49
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.45
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	55.71
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	54.86
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.22
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.05
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.29
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.72
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.51
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.86
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.60
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.85
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.62
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.38
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.95
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.79
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.24
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.11
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.61
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.39
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	47.13
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.92
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.09
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.82
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.53
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.88
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.83
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.60
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.83
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.66
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.73
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.62
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	232.78
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.27
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.07
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.83
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	70.77
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.29
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.79
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.33
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.42
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.77
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.91
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.40
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	167.86
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	90.04
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.21
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.00
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.95
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.58
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.46
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.76
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.92
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.49
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.08
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.42
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.98
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.63
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.23
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.69
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	246.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	88.48
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.83
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	74.67
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.73
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.64
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.94
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.66
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.68
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.34
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.57
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.52
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.49
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.28
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	138.99
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	109.77
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.63
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.59
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	52.61
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.38
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.38
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.61
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.84
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.87
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.08
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.02
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.48
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.73
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.73
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.22
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.15
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.31
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.24
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.56
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.60

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.