Gene detail

Detailed information of OS493_026181-T1 in Lophelia pertusa

Genomic Location: scaffold_133:796229...806953
NR annotation: KAJ7390306.1, Peroxisome biosynthesis protein pex1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_026181-T1

ATGAATCGGGTCAGATCAGCTTGTGTAAAGACAAACTCATCGAAAACCTGCTTTGTTAGTCTTTCTGAAGACCTCGCAGAGGCGATAGGACTACGAATTCAGGGTCAACCTTTTGCTCTTCAACTGCAGTGGTCAGATAGCAAGGCCTTTACCAGCTGGTCTGGTGAGGTCATACGCAGCAAGAAACATGATCCCTTAAATGGTTCATCATCTGTTATCCAACTTGGAAAAAGTATAGTGGAACCCGTCATTAGCATCACATCATGCAACAGAATAAGTGTGGATCCAGTTAGTGCCAATGATTGGGAGATATTGGAACTTCATGCTGGTTACATTGAGAGCCAGCTTCTCAATCAAGTGAGGGTGGTGTTCCCTGGCCAGTTACTGCCAATTTGGATTCAAAACAACATGTGCGTTCTTGTCCAAATTGTTAATCTTGAGCCTAATGCCAATTGTGTGAGGCTAGATGAGTTTACTGAAGTGGTTGTATCGCCAAAGGCAAGAACTTTTCCTCAACCAAAAAAAGACCAACAGGTGTCAGTTCTTACCGGTAAGGATATAACACCACAAGACAGCAGTCAAGCTCATGGTCTAGATACTGAACAAGAGCATGCAGCGACAAGTACGGCTTCTGTGTCTTATTTTGAGGATAGTGACAGTCAGTTGTTAACTGCGGGAACTCGTTCTTGTACCACAGATTCAGGAGACAAAGATTATTTTGTCAAAGGTGGCTTTATGTCAAGCTTTACTGGTTATCTACACACGTTATTATATCCTGATGGTGAAGAAAATCCTGTAAGTGAAAATCAGACTTCTAAATCTTTGATGCAGAAAGGAAGCAGTACACCAACTACTACTTCTACACAAAGTACTCAAAAATGTAATGGTAACATTCCCAAAGAAGCCGACTTTGATATGTGCATAAGAGTACAACCAGAGCTCACAATGAACAGCAACAAGTCAATTGTTCTGAAGTCATGGATTGGTAATTTGACAACATTTCCACCGCCAGATGGTACAATTGTAAAAACTGTTCAAATAAGTAGGTTGTTATCTCCAAAAGAGAGGGCTGCATCTCGAACAAATAGTGCATCAACAAACAGCCGTGACAACGTGGGATCAACATCGCGGGATTCTACAAACCAAGAATCTGATTCATCAAACAGAGGTATTCAAGATGCGACTGATCAGTCATCCTCTGATTCAGCCTCTGCTGGTGTACCTTCACGTCACTGGATTGTAAGGATGGTGATGACAAGCAGTATAAATAGCACCTATGTCAAACAAAAATCATGTGTATTGGGCGTGGCAGAGCATGTGTTACCAGGCCATGTGGTTATGTCCAAAGAACTGTTGCAACTCCTTGGTACAAGAGATTTATCTTTAGTTAAAATTCAGAATATCTGTTATGGACCGTCAGACATCCAAGGTGTTATCTTACATCCCTTTGGAGATACTGAACAGAAGCTTCAGGATGTTTCAGCTGAGTCAGCATTAGAAGCCTTCGAAGGGTGGATCTGTTCTGTCTGTAGCCTGGAGGCACCACTTGTACTCTGTAGTGGAATGCTGGTGTCCTTTGACATCTCTCAAGGCCATCCTCTTCAGTTTGTGGTTACAGTACTGAGCCATCACGAGACCTCCAGCTCAACGGACAAGATTCCATATTATCACTTAACCCCTGAGACCTTTGATAATGTGACAGTTGTTATAGGAACACCCCGTAACTCAGTGAATGGTTCAGAAGAATTAGTGAACGCTCAAGAAAGCAAGCCACAACATCCGAAGCATAGCATCACAGACTTGGGAGGTGTAACAGATGCTTTTCACAAATGCCTGGATCATGCCTTATCAGCCCTAGGGCAGAGACCACTATCCAATCATCTTGGAGGTAACATCATTACAGGGTTGTGCAGTGGGGCTCTGCTAATTTGTGGCAGTGGAAAAAGAGTTGATGCCATTCAAAAACAGTGGCAACAGATATTTGTTGAAGCAGCGTGGCATCAACCATCTGTTATCCTGTTTGATGACTTAGATCAAGTTGTTTCAGCTCCAAGTGCCCTCCAAGAAATGGGAGGCGAAGCTTTGTACAAACGCCGACTAGCCCAGGTATTCAAAGAACTTATCGCCACAGAGATCAACAACAATAGCAAAGTAGTTGTCATAGCAACCAGCAAGTCACGTGACTCATTGCACCCCTCACTTCTGACATCAAGAGGATGTCACGTCTTTCAGTGCTGTGCGGAGCTTCATCCACCCGACAATGACCAAAGGAAACAGATCTTATGTGCAATGGTAAACAAGAGGTTTCATTTGCAAGATCATGAGAGTTTAGAACTCAGTTTATTGGCAAAGAAACGAGGGATTCTCACCAAAAGATCTCCGATCACTGCTTGA

Transcript

OS493_026181-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O43933	Peroxisomal ATPase PEX1 OS=Homo sapiens OX=9606 GN=PEX1 PE=1 SV=1
Q5BL07	Peroxisomal ATPase PEX1 OS=Mus musculus OX=10090 GN=Pex1 PE=1 SV=2
G3GXG9	Peroxisomal ATPase PEX1 OS=Cricetulus griseus OX=10029 GN=PEX1 PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003407 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan
PF09262 all species →	PEX-1N	Peroxisome biogenesis factor 1, N-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR029067 all species →	Homologous_superfamily	CDC48 domain 2-like superfamily	Interproscan
IPR015342 all species →	Domain	Peroxisomal ATPase PEX1, N-terminal C-lobe	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR050168 all species →	Family	AAA ATPase domain-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23077 all species →	AAA-FAMILY ATPASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005777 all species →	Cellular Component	peroxisome	Interproscan
GO:0007031 all species →	Biological Process	peroxisome organization	Interproscan
GO:0005778 all species →	Cellular Component	peroxisomal membrane	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0016558 all species →	Biological Process	protein import into peroxisome matrix	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_026181-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_026181-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

105TPM > 0

7Conditions

10.6Max TPM

2.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.36	4.53
polyp at pH7 6	18	16	2.50	4.01
coral polyp · control treatment	16	16	2.49	10.61
coral polyp · oil and dispersant treatment	16	16	1.69	7.84
coral polyp · oil treatment	16	16	2.15	4.09
coral polyp · dispersant treatment	16	16	1.38	3.26
Polyp	10	7	1.13	2.99

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.53
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.87
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.51
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.40
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.30
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.13
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.12
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.12
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.04
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.00
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.94
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.82
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.70
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.38
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.99
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.01
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.60
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.54
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.43
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.36
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.29
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.99
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.95
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.92
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.38
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.32
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.93
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.65
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.57
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.61
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.95
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.96
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.75
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.39
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.39
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.53
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.51
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.34
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.08
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.78
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.52
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.84
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.07
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.74
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.70
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.56
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.53
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.42
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.19
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.13
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.92
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.80
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.65
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.64
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.09
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.39
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.19
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.88
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.63
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.51
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.13
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.83
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.76
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.73
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.70
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.57
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.55
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.04
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.76
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.26
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.83
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.45
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.10
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.59
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.47
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.22
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.21
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.13
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.95
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.80
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.40
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.31
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.05
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.99
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.34
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.29
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.95
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.